Välkommen till Resurscentrums frågelåda!

 

Vill du ha ett snabbt svar - sök i databasen: Anpassad Google-sökning
(tips för sökningen).
Använd diskussionsforum om du vill diskutera något.
Senaste frågorna. Veckans fråga.

2 frågor/svar hittade

Ljud-Ljus-Vågor [19387]

Fråga:
Varför är klorofyllet inte svart?
/Veckans fråga

Ursprunglig fråga:
Hej, jag undrar varför klorofyllet inte är svart? Jag menar, växterna vill ju ta upp så mycket solljus som möjligt, så varför är då inte växter svarta? Att växterna vid ekvatorn inte är svarta är förståeligt. De lär ju brinna upp, men här in norden är det ju brist på solljus, så varför har då inte växterna här svart klorofyll? Har det något med evolutionen att göra? Och om man då på konstgjort sätt skapar en växt med svart klorofyll, skulle denna växt då kunna konkurrera ut andra växter? / Johanna
/Johanna L, Bjärehovskolan

Svar:
Man kan tycka att det skulle vara mest effektivt om klorofyllet absorberade alla våglängder och inte bara blått och rött, se fråga 10888 . Nu fungerar emellertid inte evolutionen så att den effektivaste lösningen alltid utvecklas. För detta krävs dels en uppenbar fördel som driver evolutionen och dels att lösningen är fysikaliskt möjlig.

I fallet fotosyntes hos växter är det en mycket komplex process som antagligan bara utvecklats en enda gång med grönalger (Grönalger ) som gemensam förfader. Sedan måste det även finnas en molekyl som till skillnad från klorofyll absorberar även grönt ljus. På frågan "varför har då inte växterna här svart klorofyll?" är svaret att svart klorofyll finns inte. Jag kan tänka mig att man skulle kunna hitta något ämne som absorberar grönt ljus och som kunde komplettera klorofyll (se länk 2). Med hjälp av genteknik skulle man kanske kunna få växter att producera den grönabsorberande molekylen. Det finns emellertid andra metoder att öka effektiviteten, se nedan.

Se även diskussionen i länk 1, länk 2 och
http://simple.wikipedia.org/wiki/Chlorophyll#Why_green_and_not_black.3F

I fråga 10888 finns även en video om hur man kan optimera belysningen i växthus genom att med LED generera endast de våglängder klorofyllet absorberar.
/Peter E

Nyckelord: *biologi [20]; Darwins evolutionsteori [8]; genteknik [2]; #ljus [63];

1 http://www.askabiologist.org.uk/answers/viewtopic.php?id=3837
2 http://hyperphysics.phy-astr.gsu.edu/hbase/biology/pigpho.html

*

Blandat [13720]

Fråga:
Vad är jämförelsen mellan dagens genteknik och äldre tiders växtförädling och djuravel?
/Veckans fråga

Ursprunglig fråga:
Vad är jämförelsen mellan dagens genteknik och äldre tiders växtförädling och djuravel?
/linda s, tråsätra, åkersberga

Svar:
Hej Linda! Jag tackar för du ger mig chansen att skriva om ett ämne som ligger väl utanför mitt kompetensområde, men som trots det (eller kanske just därför) intresserat mig länge. Rebecca Brudefors, Österåker ställde ett antal frågor om liknande ämnen. För er båda vill jag rekommendera att ni börjar med att läsa i Nationalencyklopedin och en modern biologibok. Biology Animation Library är också en mycket bra (men ganska avancerad) resurs med bland annat animeringar som förklarar olika metoder inom gentekniken. Den nya biologin är också användbar.

Fysiker kan naturligtvis förklara nästan allting , men när det gäller genteknik är jag alltså amatör. Men lite synpunkter kan jag ha - helt och hållet mina privata sådana!

Vad är genteknik?

Genteknik (eller det negativa namnet genmanipulation) är en relativt ny teknik som innebär att man med tekniska, artificiella medel ändrar i arvsanlagen. Det kan vara från att få en gröda att tåla ogräsgiftet Roundup så man kan bli av med allt ogräs till att få fram en kalv med två huvuden. Arvsanlagen ligger i vad man kallar DNA. Bilden nedan visar en liten del av en DNA-dubbelspiral. Genteknik går till så att man byter ut en bit DNA mot en annan bit DNA, där den nya biten ger andra egenskaper. Hur man klipper och klistrar (transformation) på det här sättet och hur man vet vilka delar man skall byta ut (mappning) kan vi inte gå in på här, det finns mer information på BIONET, länk 2 under 'Hur händer det?'.

Med traditionella metoder (växtförädling/djuravel, se nedan) kan egenskaper bara överföras mellan samma art eller nära besläktade arter. I genetisk modifiering kan egenskaper överföras från en art till en helt annan, och till och med mellan växter och djur. Detta är tveklöst en orsak att genteknik och växtförädling/djuravel i allmänhet uppfattas så olika.

Växtförädling/djuravel och urval

är en sedan lång tid etablerad metod att få fram bättre skördar och mer lämpade djur. Det bygger på de naturliga förändringar (mutationer) som sker i arvsanlagen hela tiden hos alla organismer. Den utveckling som skett av livet under nästan 4 miljarder år från mycket enkla encelliga organismer till (som vi tycker själva kronan på verket) människan, har drivits fram av dessa naturliga mutationer och det naturliga urvalet.

Det naturliga urvalet var en teori som Charles Darwin efter mycket omfattande studier lade fram i sin bok On the Origin of Species (först publicerad 1859). Resten av boktiteln 'by Means of Natural Selection, or The Preservation of Favoured Races in the Struggle for Life' beskriver teorin mycket väl: av de olika mutationer som kommer fram hela tiden kommer i medeltal de som är bäst lämpade för överlevnad och reproduktion att föröka sig. Man får alltså en långsam utveckling mot mer sofistikerade (i motsats till primitiva) och till omgivningen anpassade arter. Detta är Darwins evolutionsteori. Observera att Darwin inte kände till gener och DNA, så han kunde inte i detalj beskriva hur mutationer och arvet gick till.

Växtförädling/djuravel (traditionell sortförbättring) utnyttjar dessa naturliga mutationer, men människan hjälper naturen på traven genom att göra urvalet. Man väljer alltså t.ex. att låta säd med kort stam eller de största biffkorna föröka sig. Man kan även välja att korsa individer med olika egenskaper för att på så sätt få nya egenskaper - hundraser är ett exempel på detta. Detta artificiella (konstgjorda, i motsats till det naturliga) urval gör att man når resultat mycket snabbare - faktiskt bara efter några generationer. För att ytterligare snabba på processen kan man öka mutationsfrekvensen med hjälp av strålning eller kemikalier.

Kloning

Man kan till gentekniken även inkludera s.k. kloning, där man tar ut DNA-uppsättningen från en organism och sätter in den i ett växande ägg i en annan. Man får då (genetiskt i varje fall) en exakt kopia av urspungsorganismen. Kloning är, tycker jag, tveksam när det gäller högtstående djur och helt förkastligt när det gäller människor.

Kartläggning av gener

Man har nu lyckats kartlägga människans arvsmassa som består av c:a 3 miljarder bitar (molekyler, ACG och T, markerade med de fyra olika färgerna i figuren nedan). All information om detta 'Human Genome Project' finns under länk 1. Så här ser en liten slumpmässigt vald del ut:

CTTAAAAAATTTGTTTTATGCAGCTCAGCAAAGTATTTTTCCTATTAGTTGTGAAACAAATACATGTGTA
GTTAAAACTGGTTGAAATGACATACCTCATATCTCTGGTAAACCTGTACTATTCTCTAAACCTGTGTAAG
GAGATCACATTGAGAAATTACACATGTATCCTAACATTTTTTTTAAAGTCTTTTTGTGAGAACATTTTAT
TTATGGTATTCTCGGTGAAAGTCAGTCTTTTGTAGGGGTGAATAAGACTTTTGAAAATAACCTCCTCAAA
AAGCTACTAAGAACATATTGTTGACTAATTTAGATTATCCTGTTTGCAGTGGCAGATTATGATGATAGCC
CAGTGAGACTGACTTTGAAACTTGATTCAAACTGTCCCTAGGGATAATTCAGACCTTTCTGTAGTAAACA
TTTCTGGTTTTTTTTTTTTTTTTTTTTTTTTTGCTAAATCCTCTTTTTTTTCCTCCTATAAGTCCACTTG
Kartläggningen hyllades för några år sedan med en TV-sändning som en fantastisk prestation (som en månlandning) med president Clinton, Tony Blair från Storbritanien, men i själva verket var det bara relativt trivialt arbete att fastställa sekvenserna. En helt annan sak är att verkligen tyda koden och förstå vad olika sekvenser betyder i termer av egenskaper. Vi är mycket långt från detta ännu.

Vad som däremot har kommit fram genom studerandet av DNA-sekvenser är släktskapet mellan olika organismer. Med klassisk biologi kunde man genom att jämföra olika egenskaper (t.ex. antal tår) få fram ett släktträd som var rimligt väl etablerat. Med DNA-teknik har släktträdet blivit mycket säkrare (se t.ex. den mycket fascinerande boken The Ancestor's Tale av Richard Dawkins). Man använder för detta framför allt de 97% av arvsmassan som inte tycks ha någon uppgift. Denna del av DNA kallas "Junk-DNA", dvs skräp-DNA.

Är genteknik farlig eller skadlig på annat sätt?

Att äta genmanipulerad majs är antagligen inte farligt (vi vet egentligen inte vilka risker som är förknippade med genetisk modifiering av livsmedel), men om majsen sprutats med växtgifter kan det naturligtvis vara skadligt.

Man skulle kunna åstadkomma t.ex. en växt som själv producerar ett gift mot skadeinsekter. Att äta denna växt skulle kunna vara skadligt.

Om bonden i ett fattigt land inte får använda en del av skörden till nästa års utsäde utan att betala det multinationella bolaget en massa pengar han inte har (därför att generna är patenterade av bolaget) är naturligtvis helt förkastligt.

Det finns enligt min åsikt ett antal problem med gentekniken som gör att man kan behöva lagstifta.

  • Oetisk förändring av egenskaperna hos djur och människor (här är boskapsrasen Belgian Blue ett exempel där även klassisk djuravel kan vara oetisk)
  • Kloning av högre djur och människa
  • Vågar vi ta risken att använda genetisk modifiering av livsmedel när vi ännu inte känner till långtidseffekterna?
  • Patent på gener
  • Framställning av skadliga organismer som t.ex. slår ut andra
  • ....
Kärnfysiker har länge fått bära hundhuvudet för konstruktionen av kärnvapen, men vi har försvarat oss med att man kan inte stoppa ökad kunskap, och att ansvaret för att kärnvapen använts är politikernas.

Vi måste agera på samma sätt vad gäller genteknik: tillåt forskning som är etiskt försvarbar med förbjud oetiska och skadliga tillämpningar. Att förbjuda gentekniska tillämpningar är emellertid svårare än att hindra att kärnvapen används, eftersom det faktiskt är betydligt lättare (kräver mindre svåråtkomlig utrustning) att tillämpa genteknik än att bygga ett kärnvapen.

*

Ursäkta att det bitvis blev lite tekniskt för grundskolestadiet, men ni kan kanske ha svaret som en grund att fortsätta studier i detta utomordentligt intressanta ämne! Det är dessutom en ämne som lämpar sig mycket bra för diskussion om moraliska och etiska problem. Länk 2 ger en startpunkt.



/Peter E

Nyckelord: genteknik [2]; Darwins evolutionsteori [8]; *biologi [20];

1 http://www.ornl.gov/sci/techresources/Human_Genome/home.shtml
2 http://www.bionetonline.org/svenska/Content/ff_eth.htm

*

Ämnesområde
Sök efter
Grundskolan eller gymnasiet?
Nyckelord: (Enda villkor)
Definition: (Enda villkor)
 
 

Om du inte hittar svaret i databasen eller i

Sök i svenska Wikipedia:

- fråga gärna här.

 

 

Frågelådan innehåller 7168 frågor med svar.
Senaste ändringen i databasen gjordes 2017-07-06 14:08:20.


sök | söktips | Veckans fråga | alla 'Veckans fråga' | ämnen | dokumentation | ställ en fråga
till diskussionsfora

 

Creative Commons License

Denna sida från NRCF är licensierad under Creative Commons:
Erkännande-Ickekommersiell-Inga bearbetningar
.