Välkommen till Resurscentrums frågelåda!

 

Vill du ha ett snabbt svar - sök i databasen: Anpassad Google-sökning
(tips för sökningen).
Använd diskussionsforum om du vill diskutera något.
Senaste frågorna. Veckans fråga.

20 frågor/svar hittade

Ljud-Ljus-Vågor [20602]

Fråga:
Hej, jag visste inte var jag skulle skicka den här frågan, om det var en biologisk frågeställning eller en fysikfråga. Men jag undrar hur växterna, och människorna också för den delen absorberar solljus? Hur går processen till? Solen, som för många människor är detta ljus ett glädjeämne, så kanske det kan hjälpa oss genom att veta hur processen går till, hur vi människor tar emot ljuset, om inte kärleken. Finns det något växterna gör till exempel innan för att förbereda sig? Vad krävs det av växterna egentligen? Jag tänker mig själva ögonblicket ljuset blir en del av växten. Det avgörande ögonblicket när en reaktion uppstår.

Glad för svar, vänliga hälsningar / Magnus
/Magnus H, Malmö

Svar:
Frågan är väl snarast biologi och kemi, men jag kan säga lite om de fysikaliska aspekterna.

Låt oss börja med några definitioner.

Ljusabsorption innebär att energin från fotoner upptas av elektroner i atomer. Fotonerna försvinner och övergår till inre energi i atomerna för att till slut övergå i värme. För de flesta material gäller att en del av infallande strålning absorberas, medan andra delar reflekteras, i många fall beror fördelningen mellan absorption och reflektion på fotonernas våglängd. (Absorption#Optik )

Fotosyntes är den process där levande organismer tar hand om energi från ljus och lagrar den i kemiska bindningar. Fotosyntesen i växter försiggår i kloroplasterna i bladen med användning av solljuset, se nedanstående figur från Kloroplast .

Fotosyntesen kan enkelt förklaras så här: Växten tar in koldioxid, vatten och solenergi som den sedan omvandlar till fritt syre och kolhydrater. Syret och kolhydraterna kan växten sedan använda under natten vid cellandningen. Se Fotosyntes och fråga 13757 .

Klorofyll är det ämne som ger växter deras gröna färg genom att det absorberar blått och rött ljus (se fråga 10888 ). Ämnet spelar en avgörande roll i fotosyntesen, det vill säga växternas omvandling av koldioxid, vatten och ljusenergi till kolhydrater och syrgas. Klorofyllet fungerar som en antenn som absorberar blått och rött ljus. Det är även involverat i transporten av energin till områden där kolhydrater bildas. Kolhydraterna är alltså ett energilagringssystem men även basen för växtens uppbyggnad av celler. Se Klorofyll och Kolhydrat .

Människan kan alltså inte tillgodogöra sig solljuset direkt utan endast indirekt i form av uppvärmning. Denna process är en enkel och ospecifik fysikalisk process. Fotosyntesen är däremot en mycket specifik och komplex process som producerar kolhydrater som är en varaktig källa till energi som kan användas både av växter och djur.



/Peter E

Nyckelord: *biologi [20]; *kemi [12]; energilagringssystem [7];

*

Ljud-Ljus-Vågor [19387]

Fråga:
Varför är klorofyllet inte svart?
/Veckans fråga

Ursprunglig fråga:
Hej, jag undrar varför klorofyllet inte är svart? Jag menar, växterna vill ju ta upp så mycket solljus som möjligt, så varför är då inte växter svarta? Att växterna vid ekvatorn inte är svarta är förståeligt. De lär ju brinna upp, men här in norden är det ju brist på solljus, så varför har då inte växterna här svart klorofyll? Har det något med evolutionen att göra? Och om man då på konstgjort sätt skapar en växt med svart klorofyll, skulle denna växt då kunna konkurrera ut andra växter? / Johanna
/Johanna L, Bjärehovskolan

Svar:
Man kan tycka att det skulle vara mest effektivt om klorofyllet absorberade alla våglängder och inte bara blått och rött, se fråga 10888 . Nu fungerar emellertid inte evolutionen så att den effektivaste lösningen alltid utvecklas. För detta krävs dels en uppenbar fördel som driver evolutionen och dels att lösningen är fysikaliskt möjlig.

I fallet fotosyntes hos växter är det en mycket komplex process som antagligan bara utvecklats en enda gång med grönalger (Grönalger ) som gemensam förfader. Sedan måste det även finnas en molekyl som till skillnad från klorofyll absorberar även grönt ljus. På frågan "varför har då inte växterna här svart klorofyll?" är svaret att svart klorofyll finns inte. Jag kan tänka mig att man skulle kunna hitta något ämne som absorberar grönt ljus och som kunde komplettera klorofyll (se länk 2). Med hjälp av genteknik skulle man kanske kunna få växter att producera den grönabsorberande molekylen. Det finns emellertid andra metoder att öka effektiviteten, se nedan.

Se även diskussionen i länk 1, länk 2 och
http://simple.wikipedia.org/wiki/Chlorophyll#Why_green_and_not_black.3F

I fråga 10888 finns även en video om hur man kan optimera belysningen i växthus genom att med LED generera endast de våglängder klorofyllet absorberar.
/Peter E

Nyckelord: *biologi [20]; Darwins evolutionsteori [8]; genteknik [2]; #ljus [63];

1 http://www.askabiologist.org.uk/answers/viewtopic.php?id=3837
2 http://hyperphysics.phy-astr.gsu.edu/hbase/biology/pigpho.html

*

Blandat [19176]

Fråga:
Vad har den vulkaniska aktiviteten har betytt för livets uppkomst?
/Veckans fråga

Ursprunglig fråga:
Jag undrar på vilket sätt "livet på jorden" har vulkanismen att tacka och vad egentligen den vulkaniska aktiviteten har betytt för jorden uppkomst?
/Emelie A, Lars Kaggskolan, Kalmar

Svar:
Mja, kanske inte direkt men kombinationen hav och kontinentaldriften har en stabiliserande verkan på koldioxidhalten och därmed på jordens temperatur, se fråga 17321 .

Venus, som saknar hav och kontinentaldrift har en atmosfär med koldioxid av 90 atmosfärers tryck och därmed, genom en extrem växthuseffekt, en yttemperatur på uppemot 500oC, en temperatur som omöjliggör liv som vi känner det.

Det är möjligt att domänen arkéer (se Arkéer ) är ursprunget till liv i s.k. "black smokers" (se Hydrothermal_vent ).

Vulkanism har även antagligen orsakat massutdöenden som stimulerat utvecklingen av nya arter (se Massutdöende ).
/Peter E

Nyckelord: *geologi [16]; Venus [9]; växthuseffekten [30]; vulkanism [5]; *biologi [20];

*

Blandat [19042]

Fråga:
Vi har gjort två slutna biosfärer i Biologin och ska nu studera vattnets kretslopp i biosfärerna.

Biosfär 1 har ruttnat och det växer något grönt i botten på den, vad kan det vara?

Biosfär 2 har blommat en gång och den växer fortfarande fint.

Men nu till huvudfrågan:

Vilka olika sorters vatten kretslopp fungerar inuti en sådan biosfär?

Mikronivå = fotosyntesen? Makronivå = "regn"?

Finns det fler kretslopp som kan fungera inuti en biosfär?
/Jonas K, Sunnerbogymnasiet, Ljungby

Svar:
Jonas! Detta är ju biologi och inte fysik, så jag kan inte säga så mycket.

Det gröna i botten på Biosfär 1 är säkert mögel pga övervattning, se Damejeanne och nedanstående bild:
"Det svåraste momentet med uppstarten av ett slutet kretslopp är fuktigheten. Det blir lätt för mycket vatten i kretsloppet vilket leder till att växterna möglar och man får börja om igen. Oftast behöver man inte tillsätta något vatten eftersom systemet klarar sig på fuktigheten som redan finns i jorden."

Vad gäller kretsloppen har du helt rätt, det mikroskopiska beskrivs i fråga 13757 och det makroskopiska är transport i växtens kapillärer, avdunstning från bladen (Klyvöppning ), kondensation (i naturen molnbildning) och droppar som faller ner igen (regn).

Se även Closed_ecological_system .



/Peter E

Nyckelord: *biologi [20];

*

Blandat [18651]

Fråga:
I en undersökning har jag och en klasskamrat testat hur stor kraft ägg klarar utan att spricka. Vi testade råa, löskokta och kokta ägg, där de råa och löskokta klarade betydligt större kraft än de hårdkokta. Vi antar att det har något med värmen och trycket inifrån, men hur fungerar det mer detaljerat? Och varför klarar det löskokta ägget ändå lika stor kraft som det råa?
/Johanna Ö, Katedralskolan, Lund

Svar:
Johanna och klasskamrat! Det är inte allt som går att förklara, så man får spekulera. Antingen är det som ni säger att det är högre tryck innifrån när innehållet är flytande eller så påverkas skalets hållfasthet negativt av hög temperatur.

Man kan ge ett biologisvar också. Det är uppenbart att ett hållbart ägg har ett överlevnadsvärde. Därför har evolutionen optimerat (gjort så bra som möjligt) äggets form och struktur. Detta gäller förstås bara okokta ägg - koka ägg är inte ett natulig process.

Äggstra:

Se länk 1 om hur man bestämmer om ett ägg är hårdkokt. I fråga 16238 diskuteras varför ägg inte är runda.
/Peter E

Nyckelord: *biologi [20];

1 http://www.wikihow.com/Tell-If-Eggs-Are-Raw-or-Hard-Boiled

*

Blandat [18578]

Fråga:
Hej! I vetenskapskolumnen i DN söndag 18/3 beskrivs anledningen till att jättebläckfisken har ögon stora som fotbollar är att den skall kunna se jagande kaskeloter på t ex 500 m djup, ett djup som inte släpper ner något ljus, men det alstras ett svagt ljus av kaskeloter simning, tycks det, och bläckfisken kan då fly. Hur alstras det ljuset??
/Thomas Å, Knivsta

Svar:
Länk 1 innehåller DN-artikeln.

Kaskeloten har ingen ljuskälla själv men den kan trigga andra bioluminiscenta organismer (fråga 2439 ). Citat från originalartikeln (länk 2):

Objects moving through the water are known to trigger bioluminescence in a multitude of organisms throughout the water column. Such stimulated bioluminescence can reveal the moving object either as a number of individually visible point sources or as an extended source without resolution of the individual sources.

Så jättebläckfiskens stora ögon är till för att (indirekt) upptäcka kaskeloterna som gillar att äta bläckfisk. En annan möjlighet vore att bläckfisken utvecklat detektorer för sonar-signalerna som kaskeloten använder, men undersökningar har visat att bläckfisken är döv för sonar-signalen.

Tack till huvudförfattaren Dan N för klargörande och originalartikeln!
/Peter E

Nyckelord: ultraljud [8]; luminiscens [5]; *biologi [20];

1 http://www.dn.se/nyheter/vetenskap/karin-bojs-att-ata-eller-atas--det-ar-ogonen-som-avgor
2 http://www.cell.com/current-biology/abstract/S0960-9822(12)00182-0

*

Blandat [18018]

Fråga:
Varför går björnen i ide?
/Madeleine G, Hörningsnäs, Huddinge

Svar:
Knappast en fysikfråga, men det kan förklaras av normal evolution: det har överlevnadsvärde för att det hjälper björnen genom den besvärliga vintern med kyla och brist på föda (ingen honing ). Björnen har ingen djup dvala men kroppstemperaturen och hjärtfrekvensen sjunker lite.

Se fråga 14723 för mer om Darwins evolutionsteori.
/Peter E

Nyckelord: Darwins evolutionsteori [8]; *biologi [20];

*

Blandat [17853]

Fråga:
Hej! Min materiaförståelse har fått sig en knäck. När vi lär oss om genetik och celldelning säger vi att cellen kopierar sig själv. Då får vi två celler. Varifrån kommer materian i den "nya" cellen? Ingen ny materia har väl bildats? Och varifrån kommer massan? Red gärna ut detta för mig!
/Jenny L, öjersjö brunn, öjersjö

Svar:
Jenny! Ett av de viktigaste kriterierna för liv (se fråga 13211 ) är metabolism dvs att organismen tar i in ämnen som ger energi och byggmaterial. Intaget sker för djur genom att de äter och för växter genom intag av vatten med näringsämnen. De flesta organismer tar även in luft: djur använder syret och växter koldioxid. Till skillnad från djur tar växter inte in energibärande molekyler, utan energin kommer oftast från solstrålningen genom fotosyntes.
/Peter E

Nyckelord: *biologi [20];

*

Blandat [16671]

Fråga:
Har bakterier hjärna?
/Veckans fråga

Ursprunglig fråga:
Har bakterier hjärna?
/kia m, nya stenkulaskolan, malmö

Svar:
Hej Kia! Intressant fråga. Skall försöka säga lite även om det är biologi och inte fysik. Det är i varje fall NO, och jag tror jag är behörig där .

Nej, bakterier har ingen hjärna. Hjärnan är den centrala delen av nervsystemet, och bakterier (och växter) har inget nervsystem. Wikipedia (Hjärna ) säger om hjärnan:

Hjärnan är en del av det centrala nervsystemet och utgör dess styrande del. Den kontrollerar och koordinerar kroppsfunktioner som hjärtat, blodtryck, vätskebalans och kroppstemperatur och mentala funktioner som intellekt, känslor, minne och inlärning.

Så hjärnan är en del i ett signalsystem i vilket information går både till och från hjärnan.

Naturligtvis behöver även bakterier styra de processer som är nödvändiga, men det gör de på ett mer fundamentalt sätt med hjälp av proteiner som i sin tur styrs av arvsmassan DNA. Man kan kan säga att bakterier har en enkel dator med hårddisk med data (DNA) och program (proteiner) som styr processerna. Den mänskliga hjärnan är mycket mer komplex än någon dator vi kan tillverka. Än så länge får man tillägga.
/Peter E

Nyckelord: *biologi [20];

*

Universum-Solen-Planeterna [16561]

Fråga:
Finns någon anledning till att man säger att marsmänniskor ska vara just gröna?
/Veckans fråga

Ursprunglig fråga:
Finns någon anledning till att man säger att marsmänniskor ska vara just gröna?
/Å-L W

Svar:
Intressant fråga! Låt oss beakta två aspekter på frågan: var uttrycket kommer ifrån och vilka egenskaper skulle ET ha om vi skulle möta honom?

Uttrycket "Little green men"

Det finns en lång och mycket initierad artikel i Wikipedia om var uttrycket "little green men" kommer ifrån, se Little_green_men . Det är klart att uttrycket är mycket äldre än man skulle kunna vänta sig - omkring sekelskiftet 1800-1900 - och att ursprunget är svårt att spåra.

Uttrycket var populärt på 1950-talet då det gjordes en hel del Science Fiction kalkonrullar, även om dessa för det mesta var i svart/vitt. Jag skulle ha gissat på att uttrycket uppkom som en nedsättande beteckning på de varelser som kom hit med de flygande tefat som förekom i media mycket på 1950-talet. Anledningen till att de blev gröna var kanske att grön är en färg som inte förekommer på människor.

Uttrycket är emellertid mycket välkänt. En av de mer kända användningarna var 1967 då Jocelyn Bell Burnell and Antony Hewish från Cambridge, UK i sin loggbok kallade den först upptäckta pulsaren för LGM-1 ("Little Green Men") för att de snabba, regelbundna signalerna skulle kunna komma från intelligenta varelser. Beteckningen ändrades senare till CP 1919, och heter nu det fantasilösa PSR B1919+21 (Pulsating Source of Radio). Se Pulsar .

Hur skulle en extraterrest varelse kunna se ut?

[Idéerna i detta avsnitt kommer till en del från det mycket intressanta sista kapitlet i Lewis Dartnells bok Life in the Universe (Oneworld, Oxford, 2007).]

Låt oss kalla vår vän ET. Hon/han/det (ET behöver inte föröka sig sexuellt, även om detta är den dominerande metoden på jorden) är en intelligent utomjording med utvecklad teknologi.

Bakgrund

Jorden och solsystemet skapades ur ett gas/stoftmoln för c:a 4.6 miljarder år sedan. Eukaryoter (bestående av celler med cellkärna) har funnits på jorden i över 2 miljarder år. Komplexa djur/växter har funnits c:a 0.5 miljarder år. Någon sorts enkelt encelligt liv (prokaryoter) kan ha funnits för 3.5-3.8 miljarder år sedan.

Man kan se på utvecklingen av liv att Moder Natur snarare är en knåpare (eng. tinkerer) än en uppfinnare (eng. inventor). Lösningar återanvändes snarare är att det kommer fram nya, och utvecklingen sker i små steg. Grunderna för det liv som vi ser i dag fanns redan i början.

Möjliga lösningar begränsas av naturlagarna, vilket betyder att samma lösning på ett problem kommer upp i flera sammanhang. Ögat som däggdjur har med en lins och en ljuskänslig yta har t.ex. uppkommit vid flera tillfällen oberoende av varandra, se Öga#Ögats_utveckling . Naturligt urval hos vitt skilda organismer har konvergerat mot en och samma lösning. Detta bör även gälla extraterrest liv eftersom naturlagarna är desamma - detta är åtminstone vad vi antar.

Vilka fler egenskaper kan på detta sätt tänkas vara universella hos ET?

Universella egenskaper

Flygförmåga är sannolikt en egenskap som utvecklas av några arter på en jordliknande planet eftersom det ger stora fördelar för att undvika rovdjur och för att söka föda. Tvärtemot vad man kanske väntar sig bör flygförmåga vara svårare på en liten planet med låg tyngdkraft. Detta eftersom en sådan planet antagligen har en tunn atmosfär. På en större planet med tjockare atmosfär skulle det vara enklare att flyga eftersom man får tillräcklig lyftkraft med rimligt stora vingar. ET som intelligent varelse kan antagligen inte flyga eftersom överlevnadsvärdet är marginellt - ET kan säkert försvara sig på andra sätt.

En annan egenskap som antagligen är universell är att de flesta djur består av en matsmältningskanal med en ingång och en utgång. Detta är ett effektivt sätt att få i sig den näring som krävs för att dels upprätthålla kroppstemperaturen (vi antar att intelligenta varelser inte kan vara växelvarma), hålla igång en hjärna och driva extremiteter för transport och manipulation.

I detta sammanhang kan vi observera att det är svårt att tänka sig högre stående djur utan växtlighet som kan ge näring. Fotosyntesen ger visserligen energi, men den är alltför ineffektiv (c:a 8% verkningsgrad) för att ett djur skall kunna använda den direkt. Växterna kräver mycket lite energi, så de klarar uppgiften att producera syre och kolhydrater som sedan djuren kan dra nytta av.

Vad gäller växter bör följande egenskaper optimeras: möjlighet att ta upp och lagra vatten, utbyte av gaser med atmosfären, infångandet av solljus, spridande av sporer (frön) och mekanisk stabilitet.

ET bör dessutom ha något sorts internt transportsystem för syre och energi. Hemoglobin innehållande järn är det vanligaste för syretransport, men man kan tänka sig andra transportämnen - vissa krabbor har t.ex. blått blod innehållande koppar.

Hörsel och känsel är självklara sinnen som bör utvecklas som komplement till synen (se ovan). Det krävs också en hjärna för att behandla komplicerade sinnesintryck och för att utveckla intelligens. För att minimera reaktionstiden kan sinnesorganen och hjärnan samlas på ett ställe, som vi kan kalla huvud. Hur sinnesorganen ordnas kan variera, men för både syn och hörsel är mer än ett sinnesorgan en fördel (stereoeffekt). Antal och typ av extremiteter, mönster/färg på huden kan även variera, men intelligenta varelser som utvecklar teknologi måste ha god förmåga att manipulera föremål. (Det är svårt att se hur delfiner skulle kunna utveckla teknologi.)

Hur ser ET ut?

ET måste ganska säkert vara ett landdjur. Eftersom ET förbrukar mycket energi är han antagligen åtminstone delvis köttätare. ET kan ha vilken färg som helst. Grön indikerar antingen att ET är fotosyntiserande (inte troligt, se ovan) eller kamouflerad för att gömma sig bland växter (det behöver han knappast). Dessutom är färger subjektiva för människan eftersom vi utvecklat tre sensorer känsliga för specifika våglängder i för oss synligt ljus (se fråga 16135 ).

ET har antagligen linsögon som vi, och om hans centralstjärna har lite lägre temperatur än solen skulle han säkert ha sensorer för infrarött.

Övriga egenskaper

Ett ytterligare skäl att ET troligen är köttätare är utvecklingstrycket: en jägare måste utvecklas för att lura sitt byte medan ett betande djur inte har samma behov till utveckling.

ET måste vara social och kunna leva i ett samhälle där man kan samla kunskap och föra den vidare till senare generationer. För detta krävs ett språk (tal eller tecken) och antagligen något sorts skriftspråk.

ET bör inte vara alltför aggressiv mot sina artfränder - då hade han säkert utrotat sig själv på ett tidigt stadium.

Andra former av liv

Ovanstående bygger på att liv är någotsånär som på jorden, dvs kol/vatten-baserat. Man kan naturligtvis tänka sig helt annorlunda livsformer, se ett par exempel i fråga 15912 . Att identifiera sådant liv - när vi inte vet vad vi skall leta efter - kan emellertid vara svårt.

Se vidare Extraterrestrial_life och Utomjordiskt_liv .

Bilden nedan är från Wikimedia Commons (länk 1 nedan).

/*fa2010_3



/Peter E

Nyckelord: astrobiologi [9]; liv i universum [9]; *biologi [20];

1 http://commons.wikimedia.org/wiki/File:LittleGreenMen.png

*

Ljud-Ljus-Vågor [15260]

Fråga:
Jag undrar om ni vet hur långt ljus kan gå i vatten. Jag arbetar nämligen med livsformer under isen på antarktis och undrar om det finns någon möjlighet att någon form av ljus eller strålning (något energrikt) kan gå igenom flera tusen meter vatten. Om det kan gå igenom vatten på sådant avstånd,skulle det då kunna ske på samma sätt genom is?

Är den energin tillräcklig för att mikrober skall kunna ha den som energikälla?
/Sebastian Å, Sjölins Gymnasium, Göteborg

Svar:
Det beror mycket på hur klart vattnet är men för det klaraste havsvattnet återstår mindre än 0.5% av ljuset efter 200 m, se länk 1. Det är inte någon stor skillnad på vatten och ren, klar is. Is (speciellt is bildad av komprimerad snö) innehåller emellertid ofta luftbubblor, och då är absorptionen mycket högre.

Vostok-sjön (se länk 2) är en stor insjö 4 km under isen i Antarktis. Det är uppenbart att nästan inget ljus når dit. Man har emellertid borrat nästan ända ner till sjön och hittat bakterier.

Allt liv behöver energi (se livets uppkomst för kriterier för liv), men inte nödvändigtvis ljus. Växter får energi från ljus och bygger upp kolhydrater. Djur kräver inte ljus för sin energiförsörjning (men säkert för andra ändamål) utan får energi direkt eller indirekt från de av växterna tillverkade kolhydraterna.

Det finns livsformer i djuphavet vid utlopp av vamvatten från vulkanism (extremofiler, googla black smokers). Några organismer använder det upp mot 400 grader varma vattnet som energikälla. Andra organismer använder de av de första bildade kemiska föreningarna som energikälla.

Vostok-sjön är mycket intressant eftersom förhållanden mycket liknar de på jupitermånen Europa. Om det finns något liv i Vostok-sjön beror framför allt på om där finns någon energikälla. Vi får se vad man hittar när man hittat en säker metod att studera sjön med.
/Peter E

Nyckelord: astrobiologi [9]; *biologi [20]; #ljus [63];

1 http://oceanworld.tamu.edu/resources/ocng_textbook/chapter06/chapter06_10.htm
2 http://en.wikipedia.org/wiki/Lake_Vostok

*

Blandat [14559]

Fråga:
Vad är extremofiler?
/Veckans fråga

Ursprunglig fråga:
Skriver ett arbete om astrobiologi, har försökt att hitta info om följande (men misslyckats) En bakterie som lever under extrema förhållande med från plusgrader ner till -80 grader vad lever den på? Hur producerar den DNA/protein samt hur påverkas bakterier av gravitaion? Vore tacksam för svar för har sökt jättemycket men inte hittat detta.
/Anton J, Löfströms gymnasium, Sundbyberg

Svar:
Anton! Mycket specialiserade frågor, och eftersom astrobiologi är multidisciplinärt (omfattar flera ämnen) kan jag inte ge så mycket detaljer, utan du får nöja dig med ett allmänt hållet svar.

Det du nämner är ett exempel på s.k. extremofiler, dvs organismer som kan överleva och tom trivas (föröka sig) under vad vi uppfattar som extrema förhållanden. Extremofiler av olika typer, se länk 1, har upptäckts de senaste trettio åren. Det finns nästan inga platser på jorden där det inte vimlar av liv, tom långt ner i bergrunden! Upptäckten ökar möjligheten att hitta enkelt (encelligt) liv på andra planeter, eftersom begränsningarna i miljön är mindre än vad man tidigare trott. Det ger dessutom alternativa scenarios för livets uppkomst på jorden.

Det du pratar om är 'psychrophile' som kan föröka sig ner till -10 grader, se länk 2. Vid så låga temperaturer som -80 grader finns antagligen inget aktivt liv men s.k. endosporer kan "övervintra" under mycket lång tid vid dessa temperaturer. Aktiva livsprocesser kräver sannolikt flytande vatten, så temperaturen kan inte gå mycket under -10 grader även om vissa organismer har någon sorts anti-frysvätska liknande den man använder i kylaren i en bil.

Skälen till att en organism inte kan frysa är dels att det behövs en vätska för att transportera energiämnen och närings/byggnadsämnen och dels att frysning spränger sönder celler eftersom is har lägre densitet är vatten.

Bilden nedan (från Wikimedia Commons ) visar termofila bakterier från Grand Prismatic Spring, Yellowstone National Park, USA.

Se vidare Extremophiles , som innehåller en lista på olika typer av extremofiler.



/Peter E

Nyckelord: astrobiologi [9]; *biologi [20];

1 http://www.daviddarling.info/encyclopedia/E/extremophile.html
2 http://www.daviddarling.info/encyclopedia/P/psychrophile.html

*

Blandat [14232]

Fråga:
Jag har hört att fysiken är den egentliga naturvetenskapen och all naturvetenskap egentligen är fysik. Är det så?
/Veckans fråga

Ursprunglig fråga:
Jag har hört att fysiken är den egentliga naturvetenskapen och all naturvetenskap egentligen är fysik. Kemi och bilogi skulle alltså vara delar av fysiken. Min lärare säger att det är ur fysiken som kemin kom och ur kemin kom biologin? Vad menas med detta? jag förstår inte riktigt vad min lärare menar när hon säger detta och hon vill inte förklara det mer ingående. mycket tacksam för svar
/Anna L, Gränbyskolan, Uppsala

Svar:
Anna och även Tanja som ställt en liknande fråga!

Att definiera fysik är inte lätt - definitionen beror på sammanhanget. Om man t.ex. menar skolämnet fysik så är det emellertid lätt: fysik är det som ingår i kursplanen för fysikämnet. Om man menar forskningsämnet fysik är det de områden man forskar om på fysiska institutioner vid universiteten. Den preliminära kursplanen för fysik i det nya gymnasiet GY-07 inleds med följande tre stycken:

Ämnet Fysik syftar till fördjupad förståelse för hur fenomen i den egna vardagen och i universum kan förklaras med fysikaliska modeller. Ämnet Fysik syftar också till ett vidgat naturvetenskapligt perspektiv och en modern naturvetenskaplig världsbild. Utbildningen syftar till att öka intresset för ämnet och för fortsatta studier i fysik, matematik, andra naturvetenskapliga ämnen och teknik.

Fysikämnet omfattar allt ifrån det allra minsta, mikrokosmos, till det allra största, makrokosmos. Utbildningen i ämnet syftar till att ge eleven en inblick i olika områden inom fysiken samt dess olika tillämpningar inom vardag, samhälle, industri och forskning.

I all naturvetenskap sker utveckling i samspel mellan experiment och teori. Teorier och modeller är mänskliga tankekonstruktioner som ständigt utvecklas och påverkar människans världsbild. Utbildningen i Fysik syftar därför till ökad kunskap om fysikens arbetsmetoder samt om hur fysikens kunskapsområden utvecklas i samspelet mellan fysik, andra naturvetenskapliga ämnen och matematik.

En alternativ definition är: fysik är den vetenskap som beskriver materia, energi och krafter. Då fysiken är en vetenskap tillämpas den vetenskapliga metoden (se vetenskaplig metod ), med uppställande av hypoteser som antingen förkastas eller antas på grundval av experiment och observationer.

Man skiljer även på klassisk fysik (allt före 1900, t.ex. mekanik, elektromagnetism) och modern fysik (t.ex. relativitetsteori, kvantmekanik, elementarpartikelfysik). Sedan har man även grundläggande fysik (forskning inom fysik som motiveras av vår vilja att förstå naturen) och tillämpad fysik (tekniska, medicinska, mm tillämpningar av fysik).

Eftersom modern fysik omfattar vetande från i stort sett hela 1900-talet, kan det vara på sin plats att använda begreppet nutida fysik som skulle innefatta partikelfysik (standardmodellen ), kosmologi (big bang ), plasmafysik och fusion (fusion ) och kärnfysik, se länk 1 för detaljer om Contemporary Physics Education Project (CPEP).

Historiskt var det så att fysik var all naturvetenskap. Efter hand som kunskapen ökade, hade man behov av specialisering. Efter hand frigjordes biologi, geologi, kemi, m.fl. och blev egna ämnen. Vad din lärare antagligen menar är att t.ex. biologin bestäms helt och hållet av arvet genom DNA-molekylen. De lagar som styr DNAs egenskaper är fysik (kvantmekanik). DNA-molekylernas egenskaper är emellertid så komplicerade att vi inte kommer särskilt långt i förståelsen med kvantmekanik. Man måsta använda andra metoder för att komma framåt, och då är det praktiskt att ge ämnet en egen beteckning.

Historiskt har biologin utvecklats helt oberoende av fysiken: man studerade och klassificerade organismer (Linné, 1700-talet), och efter hand förstod man arv och utveckling (Mendel, Darwin, 1800-talet) och DNA upptäcktes (Watson, Crick, Wilkins och Rosalind Franklin, 1950-talet, se länk 2). Det var egentligen först då kopplingen till fysik återuppstod i form av t.ex. biofysik. Se vidare fråga 13720 .

Även det vi i dag kallar fysik har delats upp i separata ämnen: i början av 1900-talet kallades allt som hade att göra med atomer för atomfysik. Efter hand som kunskaperna ökade frigjordes kärnfysik (som beskrev atomkärnan, atomfysik beskrev bara elektronerna kring kärnan). Efter 1950 frigjordes sedan elementarpartikelfysiken från kärnfysik och blev ett eget ämne som behandlar elementarpartiklar och deras växelverkningar.

För att visa hur krånglig och godtycklig uppdelningen är kan jag säga att delar av kärnfysik i USA klassificeras som kemi (Nuclear Chemistry).

Mer om vad fysik är och vad det är bra för finns under nedanstående länkar och här: fysik, nytta med . Jag beklagar om svaret inte är lätt att förstå, det går nog tyvärr inte att förklara det enklare.

Texten på tröjan nedan antyder att fysiken är den ultimata vetenskapen .



/Peter E

Nyckelord: fysik [10]; *biologi [20]; vetenskaplig metod [18]; kursplan [3];

1 http://www.cpepweb.org/
2 http://www.chemheritage.org/discover/online-resources/chemistry-in-history/themes/biomolecules/dna/watson-crick-wilkins-franklin.aspx

*

Universum-Solen-Planeterna [13997]

Fråga:
Jag gör ett skolarbete om beboliga zoner: Det avstånd från en stjärna som skulle vara beboligt om man hade en lämplig planet (en planet liknande jorden).

Hur beräknar man värmestrålningen, radioaktiva strålningen, röntgenstrålningen och UV-ljuset från en stjärna till en planet på ett visst avstånd? Finns det något samband mellan värmestrålningen i en viss sektor från stjärnan, stjärnans storlek, stjärnans spektralklass och avståndet till den "beboliga" himlakroppen?

Mellan vilka temperaturer kan man leva? Hur mycket värme- / ultraviolet- / röntgen- / gammastrålning absorberar ozonlagret från en atmosfär liknande jorden? Hur mycket ultaviolet- / röntgen- / gammastrålning kan man leva med utan hälsorisker?

Vad ska jag mer tänka på?

Väldigt tacksam för svar. Tack för mycket bra tidigare svar! Hoppas ni ytterligare en gång överträffar mina förhoppningar.
/Daniel B, Röllingby, Åkerberga

Svar:
Hej Daniel, vi får se hur nöjd du blir. Det är klart att problemet är komplext, så exakta svar går inte att ge. Vi har svarat på besläktade frågor tidigare, se länken astrobiologi nedan. Du skall dessutom göra lite själv också, så jag har en del länkar till bra sajter. Tyvärr finns det ännu ingen bra bok på svenska i det nya ämnet Astrobiologi.

Några bra länkar:
Life in the Universe: The Evolution of Habitability
Astronomy tutorials (speciellt Surface Temperature of Terrestrial Planets)
Stars and Habitable Planets
How common are habitable planets?

Se även länksamlingen länk 1.
/Peter E

Nyckelord: astrobiologi [9]; *biologi [20];

1 http://fragelada.fysik.org/links/search.asp?class2=%2619%3B
2 http://en.wikipedia.org/wiki/Astrobiology

*

Blandat [13720]

Fråga:
Vad är jämförelsen mellan dagens genteknik och äldre tiders växtförädling och djuravel?
/Veckans fråga

Ursprunglig fråga:
Vad är jämförelsen mellan dagens genteknik och äldre tiders växtförädling och djuravel?
/linda s, tråsätra, åkersberga

Svar:
Hej Linda! Jag tackar för du ger mig chansen att skriva om ett ämne som ligger väl utanför mitt kompetensområde, men som trots det (eller kanske just därför) intresserat mig länge. Rebecca Brudefors, Österåker ställde ett antal frågor om liknande ämnen. För er båda vill jag rekommendera att ni börjar med att läsa i Nationalencyklopedin och en modern biologibok. Biology Animation Library är också en mycket bra (men ganska avancerad) resurs med bland annat animeringar som förklarar olika metoder inom gentekniken. Den nya biologin är också användbar.

Fysiker kan naturligtvis förklara nästan allting , men när det gäller genteknik är jag alltså amatör. Men lite synpunkter kan jag ha - helt och hållet mina privata sådana!

Vad är genteknik?

Genteknik (eller det negativa namnet genmanipulation) är en relativt ny teknik som innebär att man med tekniska, artificiella medel ändrar i arvsanlagen. Det kan vara från att få en gröda att tåla ogräsgiftet Roundup så man kan bli av med allt ogräs till att få fram en kalv med två huvuden. Arvsanlagen ligger i vad man kallar DNA. Bilden nedan visar en liten del av en DNA-dubbelspiral. Genteknik går till så att man byter ut en bit DNA mot en annan bit DNA, där den nya biten ger andra egenskaper. Hur man klipper och klistrar (transformation) på det här sättet och hur man vet vilka delar man skall byta ut (mappning) kan vi inte gå in på här, det finns mer information på BIONET, länk 2 under 'Hur händer det?'.

Med traditionella metoder (växtförädling/djuravel, se nedan) kan egenskaper bara överföras mellan samma art eller nära besläktade arter. I genetisk modifiering kan egenskaper överföras från en art till en helt annan, och till och med mellan växter och djur. Detta är tveklöst en orsak att genteknik och växtförädling/djuravel i allmänhet uppfattas så olika.

Växtförädling/djuravel och urval

är en sedan lång tid etablerad metod att få fram bättre skördar och mer lämpade djur. Det bygger på de naturliga förändringar (mutationer) som sker i arvsanlagen hela tiden hos alla organismer. Den utveckling som skett av livet under nästan 4 miljarder år från mycket enkla encelliga organismer till (som vi tycker själva kronan på verket) människan, har drivits fram av dessa naturliga mutationer och det naturliga urvalet.

Det naturliga urvalet var en teori som Charles Darwin efter mycket omfattande studier lade fram i sin bok On the Origin of Species (först publicerad 1859). Resten av boktiteln 'by Means of Natural Selection, or The Preservation of Favoured Races in the Struggle for Life' beskriver teorin mycket väl: av de olika mutationer som kommer fram hela tiden kommer i medeltal de som är bäst lämpade för överlevnad och reproduktion att föröka sig. Man får alltså en långsam utveckling mot mer sofistikerade (i motsats till primitiva) och till omgivningen anpassade arter. Detta är Darwins evolutionsteori. Observera att Darwin inte kände till gener och DNA, så han kunde inte i detalj beskriva hur mutationer och arvet gick till.

Växtförädling/djuravel (traditionell sortförbättring) utnyttjar dessa naturliga mutationer, men människan hjälper naturen på traven genom att göra urvalet. Man väljer alltså t.ex. att låta säd med kort stam eller de största biffkorna föröka sig. Man kan även välja att korsa individer med olika egenskaper för att på så sätt få nya egenskaper - hundraser är ett exempel på detta. Detta artificiella (konstgjorda, i motsats till det naturliga) urval gör att man når resultat mycket snabbare - faktiskt bara efter några generationer. För att ytterligare snabba på processen kan man öka mutationsfrekvensen med hjälp av strålning eller kemikalier.

Kloning

Man kan till gentekniken även inkludera s.k. kloning, där man tar ut DNA-uppsättningen från en organism och sätter in den i ett växande ägg i en annan. Man får då (genetiskt i varje fall) en exakt kopia av urspungsorganismen. Kloning är, tycker jag, tveksam när det gäller högtstående djur och helt förkastligt när det gäller människor.

Kartläggning av gener

Man har nu lyckats kartlägga människans arvsmassa som består av c:a 3 miljarder bitar (molekyler, ACG och T, markerade med de fyra olika färgerna i figuren nedan). All information om detta 'Human Genome Project' finns under länk 1. Så här ser en liten slumpmässigt vald del ut:

CTTAAAAAATTTGTTTTATGCAGCTCAGCAAAGTATTTTTCCTATTAGTTGTGAAACAAATACATGTGTA
GTTAAAACTGGTTGAAATGACATACCTCATATCTCTGGTAAACCTGTACTATTCTCTAAACCTGTGTAAG
GAGATCACATTGAGAAATTACACATGTATCCTAACATTTTTTTTAAAGTCTTTTTGTGAGAACATTTTAT
TTATGGTATTCTCGGTGAAAGTCAGTCTTTTGTAGGGGTGAATAAGACTTTTGAAAATAACCTCCTCAAA
AAGCTACTAAGAACATATTGTTGACTAATTTAGATTATCCTGTTTGCAGTGGCAGATTATGATGATAGCC
CAGTGAGACTGACTTTGAAACTTGATTCAAACTGTCCCTAGGGATAATTCAGACCTTTCTGTAGTAAACA
TTTCTGGTTTTTTTTTTTTTTTTTTTTTTTTTGCTAAATCCTCTTTTTTTTCCTCCTATAAGTCCACTTG
Kartläggningen hyllades för några år sedan med en TV-sändning som en fantastisk prestation (som en månlandning) med president Clinton, Tony Blair från Storbritanien, men i själva verket var det bara relativt trivialt arbete att fastställa sekvenserna. En helt annan sak är att verkligen tyda koden och förstå vad olika sekvenser betyder i termer av egenskaper. Vi är mycket långt från detta ännu.

Vad som däremot har kommit fram genom studerandet av DNA-sekvenser är släktskapet mellan olika organismer. Med klassisk biologi kunde man genom att jämföra olika egenskaper (t.ex. antal tår) få fram ett släktträd som var rimligt väl etablerat. Med DNA-teknik har släktträdet blivit mycket säkrare (se t.ex. den mycket fascinerande boken The Ancestor's Tale av Richard Dawkins). Man använder för detta framför allt de 97% av arvsmassan som inte tycks ha någon uppgift. Denna del av DNA kallas "Junk-DNA", dvs skräp-DNA.

Är genteknik farlig eller skadlig på annat sätt?

Att äta genmanipulerad majs är antagligen inte farligt (vi vet egentligen inte vilka risker som är förknippade med genetisk modifiering av livsmedel), men om majsen sprutats med växtgifter kan det naturligtvis vara skadligt.

Man skulle kunna åstadkomma t.ex. en växt som själv producerar ett gift mot skadeinsekter. Att äta denna växt skulle kunna vara skadligt.

Om bonden i ett fattigt land inte får använda en del av skörden till nästa års utsäde utan att betala det multinationella bolaget en massa pengar han inte har (därför att generna är patenterade av bolaget) är naturligtvis helt förkastligt.

Det finns enligt min åsikt ett antal problem med gentekniken som gör att man kan behöva lagstifta.

  • Oetisk förändring av egenskaperna hos djur och människor (här är boskapsrasen Belgian Blue ett exempel där även klassisk djuravel kan vara oetisk)
  • Kloning av högre djur och människa
  • Vågar vi ta risken att använda genetisk modifiering av livsmedel när vi ännu inte känner till långtidseffekterna?
  • Patent på gener
  • Framställning av skadliga organismer som t.ex. slår ut andra
  • ....
Kärnfysiker har länge fått bära hundhuvudet för konstruktionen av kärnvapen, men vi har försvarat oss med att man kan inte stoppa ökad kunskap, och att ansvaret för att kärnvapen använts är politikernas.

Vi måste agera på samma sätt vad gäller genteknik: tillåt forskning som är etiskt försvarbar med förbjud oetiska och skadliga tillämpningar. Att förbjuda gentekniska tillämpningar är emellertid svårare än att hindra att kärnvapen används, eftersom det faktiskt är betydligt lättare (kräver mindre svåråtkomlig utrustning) att tillämpa genteknik än att bygga ett kärnvapen.

*

Ursäkta att det bitvis blev lite tekniskt för grundskolestadiet, men ni kan kanske ha svaret som en grund att fortsätta studier i detta utomordentligt intressanta ämne! Det är dessutom en ämne som lämpar sig mycket bra för diskussion om moraliska och etiska problem. Länk 2 ger en startpunkt.



/Peter E

Nyckelord: genteknik [2]; Darwins evolutionsteori [8]; *biologi [20];

1 http://www.ornl.gov/sci/techresources/Human_Genome/home.shtml
2 http://www.bionetonline.org/svenska/Content/ff_eth.htm

*

Blandat, Universum-Solen-Planeterna [13211]

Fråga:
Vad är liv och var kom materien ifrån?
/Veckans fråga

Ursprunglig fråga:
Hur kunde de första cellerna bildas? Jag vet ju att de första djuren bildades i vattnet av celler som delade sig mm. Men hur blev det en cell från allra första början?!

Var kom all materia som finns i rymden ifrån? Har den bara svävat omkring ända tills de "fastnade" på varandra.
/Camilla O, Svaleboskolan, Veberöd

Svar:
Camilla! Den första frågan är egentligen biologi, men jag kan säga lite: Man vet inte exakt hur det gick till, men man vet att primitiva encelliga organismer uppkom ganska tidigt i jordens historia - nästan så snart förhållandena tillät, kanske för 3.8 miljarder år sedan. Sedan tog det mycket lång tid för mer komplexa flercelliga organismer att utvecklas. Se vidare de utmärkta artiklarna om liv och evolution . Se även Wikipedia (lite mer försiktighet här!) Livets_uppkomst och Abiogenesis .

Vad är liv?

Frågan kan tyckas trivial - alla kan skilja på levande och dött - men om man tänker efter är det inte så enkelt. Man brukar kräva sex egenskaper som tillsammans indikerar liv:

  1. Organisation: Materialen i levande organismer uppvisar alltid något slag av ordning t.ex. molekylerna i levande celler är inte slumpmässigt utspridda i cellerna utan är ordnade i mönster för att åstadkomma cellstruktur.
  2. Reproduktion: Enkla livsformer, såsom bakterier, förökar sig genom delning för att göra nästan exakta kopior av sig själva. Mer komplexa organismer förökar sig genom t.ex. sexuell reproduktion, i vilken avkomman får genetiskt material från två individer. Undantag finns: Virus är ett gränsfall eftersom det kräver en levande organisms celler som förmås göra kopior av viruset självt.
  3. Tillväxt och utveckling: Levande organismer växer och utvecklas åtminstone delvis genom att ärva karaktärsdrag från föräldrarna.
  4. Energiutnyttjande/material: Levande organismer behöver energi och material för att kunna skapa och vidmakthålla ordning, tillväxt och reproduktion. Detta kallas metabolism. (Entropiminskningen som ordning innebär kräver energi.)
  5. Kommunikation med omgivningen: Alla levande organismer, både enkla och högtstående kommunicerar (ser, känner, luktar...) med omgivningen.
  6. Evolution: Över tiden anpassar sig ursprungliga organismer i stor mångfald till nya organismer som är bättre anpassade till den miljö de lever i. I många fall går anpassningen så långt att det skapas helt nya arter (Darwins utvecklingslära).

Var kommer materian ifrån?

Väte och helium bildades från början i Big Bang. Alla tyngre grundämnen har bildats i stjärnor och spritts ut i rymden när stjärnorna exploderat. Sedan har molnen dragit sig samman och bildat nya stjärnor eventuellt med planetsystem. Se vidare grundämnen, bildandet av . Detta var enminutersversionen av universums utveckling .

Se även liv i universum .

Bilden nedan är en karikatyr av Darwin som apa från the Hornet magazine 1871 (se artikeln om evolution Evolution ).



/Peter E

Se även fråga 13117

Nyckelord: livets uppkomst [1]; Darwins evolutionsteori [8]; *biologi [20];

*

Universum-Solen-Planeterna [13196]

Fråga:
Finns det liv på andra planeter i universum?
/Veckans fråga

Ursprunglig fråga:
Vi har i området astronomi kommit in på frågor om möjligheten att hitta intelligent liv på andra planeter. När man beräknar antal möjliga planeter som skulle kunna hysa liv (för tex vår egen galax), vilka grundkriterier utgår man från då?

Som jag själv förstår det får inte planeten ligga alltför nära galaxens centrum, eftersom strålningen då skulle bli alltför hög; å andra sidan får den inte ligga allt för långt ut i ytterkanterna av galaxen, eftersom galaxens ytterområden saknar många av de grundämnen som är nödvändiga för liv (hur många planeter blir kvar att räkna med då i vintergatan?)

Vi måste också ha en stjärna med ett planetsystem och i detta planetsystem så måste det finnas en planet på "rätt" avstånd från stjärnan så att temperaturen blir gynsam (för temperaturer gynsamma för liv borde även planetens egen rotation kring sin egen axel, samt formen på den bana planeten tar kring sin stjärna ha betydelse!). För att planeten skall ha rätt sammmansättning av grundämnen krävs också rätt avstånd till sin stjärna

Storleken på planeten borde också vara avgörande för liv, för att alt.1: allt väte inte skall samlas på marken ( för stor planet) eller alt.2: allt syre inte skall stiga upp i atmosfären (för liten planet).

Planeten skulle också behöva en "dammsugare" typ Jupiter, som skyddar planeten mot alltför stort bombardemang av meteorer.

Kanske har jag missuppfattat en del av kriterierna för liv men, Hur stort är det teoretiska antalet planeter i Vintergatan som uppfyller kriterierna för intelligent liv och hur många sådana faktiska planeter känner man till? Var ligger de?
/Helena E, Folkungaskolan, Linköping

Svar:
Helena! Du har missuppfattat en del men mycket av det du skriver är rätt. Låt oss försöka reda ut begreppen, men observera att när det gäller liv i universum är allt bara spekulationer utifrån vad vi vet om livet på jorden. Vi känner inte till något exempel ännu.

Börja med att läsa artiklarna om liv, liv i universum och livets ursprung och SETI i Nationalencyklopedin . SETI står för Search for ExtraTerrestial Intelligense, vilket betyder sökande efter intelligent liv på andra planeter.

Vi systematiserar problemet genom att dela in det i tre steg: förutsättningar för liv, primitivt liv och intelligent liv.

Förutsättningar för liv

Om man begränsar sig till liv som vi känner till det (baserat på kol) måste det finnas förhållanden som är i närheten av förhållandena på jorden. De viktigaste förutsättningarna är

  • planet med en fast yta, lagom storlek (fast yta är möjligen inte nödvändigt för primitivt liv)
  • förekomst av flytande vatten (begränsar temperaturen till ca 0-100oC).
  • atmosfär med koldioxid och gärna ett magnetfält för att skydda atmosfären och eventuellt liv från strålning (observera att syre inte är nödvändigt för primitivt liv - syret i jordatmosfären fanns inte från början)
  • stabilt klimat under tillräckligt lång tid
Man känner till över 100 planeter kring andra stjärnor (se Planet Quest ), men dessa är för det mesta alltför varma och stora ("hot jupiters"). Detta betyder inte att det inte finns jordliknande planeter, utan är en följd av sättet man hitta dem på.

Du säger att vi inte väntar oss liv nära vintergatans centrum. Jag tror inte det svarta hålet i centrum ger så mycket strålning att det omöjliggör liv. Däremot måste gasen en stjärna med planetsystem bildas ur innehålla tillräcklig mängd tunga grundämnen för att planeter med fast yta skall kunna bildas. Detta betyder att stjärnan inte får vara alltför gammal utan vara "andra generationens" stjärna som berikats på tunga grundämnen av "första generationens" stjärnor.

Se vidare länk 1 nedan.

Primitivt liv

På jorden uppkom primitivt (encelligt, bakterieliknande) liv förvånadsvärt snabbt - på några hundra miljoner år. Detta kan antingen tyda på att uppkomsten av liv är en naturlig och enkel process eller att livet på något sätt kom någon annan stans ifrån.

Det tog emellertid mycket lång tid (flera miljarder år) för livet att utvecklas till komplexa flercelliga livsformer. Det är här man antagligen behöver en långlivat och stabil planet som ger utvecklingen den tid som behövs.

Intelligent liv

Så långt är vetenskapen på ganska fast mark, men när det gäller intelligent liv så är det mesta spekulationer. Säkert är att det finns många stjärnor med planetsystem. Antagligen finns det även många med förhållanden som tillåter liv att utvecklas. Förutom att dessa system är utspridda över ett område på ca 100 miljoner ljusår, så kan det tänkas att intelligent liv inte varar så länge. Tänk bara på vilka ansträngningar vi gör för att på olika sätt förstöra oss själva och miljön .

För mer om sökandet efter intelligent liv se SETI Institute , SETI Australia Centre , How SETI Works .

Astrobiologi - vetenskapen om liv utanför jorden - har de senaste åren etablerats som en seriös gren av naturvetenskapen. Resurscentrum för fysik och Institutionen för astronomi vid Lunds universitet ger hösten 2004 en kurs för lärare i astrobiologi (länk 2). Wikipedia-artikeln Extraterrestrial_life är bra och omfattande även vad gäller historiska aspekter.

Länksamling för Astrobiologi är en omfattande länksamling till webb-resurser som har att göra med astrobiologi.
/Peter E

Nyckelord: liv i universum [9]; astrobiologi [9]; SETI [1]; *biologi [20];

1 http://www.kepler.arc.nasa.gov/pdf_files/Lissauer.Nature402.pdf
2 http://www.fysik.org/WebSite/showPage.asp?it=258

*

Ljud-Ljus-Vågor [12255]

Fråga:
Varför ser katter bättre än oss på natten?
/johanna s, fjälkinge, fjälkinge

Svar:
Detta är naturligtvis mer en biologisk än en fysikalisk fråga.

Men vi ska ändå försöka reda ut det här. Hur ska ett öga vara konstruerat för att se bra i svagt ljus? För det första ska ögat ha en stor bländaröppning, dvs släppa in mycket ljus. Om du tittar på kattens öga när det är mörkt så ser du att pupillen kan bli stor. Sedan ska de celler som sitter i bakre delen av ögat vara känsliga. Det är säkert så, men det får biologerna svara för, att katten har fler celler som är känsliga för lite ljus dvs få fotoner. Förmodligen är det så att dessa celler inte kan diskriminera mellan olika färger utan även för katten är ”alla katter på natten gråa”.

En ytterligare anledning är att katten i ögat har ett speciellt kristallskikt, som fungerar som en spegel. Det ljus som inte omedelbart absorberas av näthinnan utan passerar förbi reflekteras tillbaka och ges en andra "chans", se Cat_senses#Sight .

Vissa djur, t.ex. den europeiska paddan, kan öka känsligheten genom öka exponeringstiden (igen en term vi känner igen från kameran). Problemet är att snabba rörelser blir suddiga, så en ökning av exponeringstiden utöver människans 0.1 sekunder är bara av värde för vissa djur, t.ex. paddan eftersom den lever på "långsamma" djur, t.ex. maskar.
/Gunnar O/Peter E

Nyckelord: *biologi [20];

*

Blandat [12292]

Fråga:
Att ett frö alltid växer uppåt beror väl på tyngdkraften? Vet du någon bra litteratur om detta, försök som gjorts, artiklar mm? Mycket tacksam för svar.
/Ulrika A, Väggaskolan, Karlshamn

Svar:
Ulrika! Det skulle även kunna bero på ljus, för vissa frön är ljuskänsliga. Även om gravitation är fysik, så är detta nog en biologifråga. Här har du några andra frågelådor: Frågelådor . Någon biologilåda tycks inte finnas, så försök ekologi, det är tillräckligt nära.

PS. NASA har gjort experiment med att låta frön gro i tynglösheten i International Space Station (ISS). Här finns en beskrivning av experimentet: Plants in space .
/Peter E

Nyckelord: *biologi [20];

*

Blandat [1550]

Fråga:
Om man skulle hitta syre i fri form på någon annan planet tyder det då på att det finns liv där ?
/Anna N, Bergaskolan, Eslöv

Svar:
 Syre i atmosfären är nog ett ganska säkert tecken på liv. Syre är ett mycket reaktivt ämne, som helst vill ingå i förening med andra ämnen. För att syrehalten ska behållas, måste det hela tiden nyproduceras. Här på jorden görs det av de gröna växterna, som av koldioxid och vatten producerar kolhydrater och syre. Energin kommer från solljuset. Detta kallas fotosyntes.

De blågröna algerna (cyanobakterier) anses vara de tidigaste syreproducenterna, och de fanns redan för 3500 miljoner år sedan. Antagligen var det en sorts giftkrig. Syre är oerhört giftigt för de organismer som inte är utrustade för att hantera det. Vi har ett mycket imponerande system som oupphörligt kollar och reparerar arvsmassan i varje cell. Annars skulle vi nog inte leva många timmar. De organismer som lärde sig hantera syret fick en oerhörd fördel. Att förbränna socker med syre (som vi gör) ger ungefär 20 gånger mera energi än att jäsa det till alkohol. Det gör oss rörliga (muskler) och är en absolut förutsättning för hjärnan - kroppens, relativt sett, mest energiförbrukande organ.

Nu kom det inte så mycket syre till atmosfären för 3500 miljoner år sedan. Det skulle dröja ytterligare 1000 miljoner år, se nedanstående diagram. Det första syret förbrukades antagligen för att oxidera järn i havsvattnet, som fälldes ut som rost på havsbottnen. En del av våra järnmalmer har uppkommit på detta vis. Dagens havsvatten är fattigt på järn, bara ett tiotusendels gram per kubikmeter. Järn behövs för de flesta former av liv. Det är den låga järnhalten, som begränsar tillväxten i havet. Ska man göda havet, ska man göra det med järn!

I National Geographic Magazine, mars 1998, finns en bra artikel som handlar om dessa saker. Du hittar den säkert på biblioteket. Där finns nog en del svåra ord, men du kan säkert få hjälp av en lärare. Bra att veta är följande:

Livsträdets (se länk 1) tre grenar:
Eukaryoter Cellen har kärna (som vi). Bakterier saknar kärna. Arkeoner saknar också kärna, men är inte bakterier. Kallades förr arkebakterier.



/KS/lpe

Nyckelord: liv i universum [9]; astrobiologi [9]; *biologi [20]; jordens atmosfär [9];

1 http://tolweb.org/tree/phylogeny.html

*

Ämnesområde
Sök efter
Grundskolan eller gymnasiet?
Nyckelord: (Enda villkor)
Definition: (Enda villkor)
 
 

Om du inte hittar svaret i databasen eller i

Sök i svenska Wikipedia:

- fråga gärna här.

 

 

Frågelådan innehåller 7168 frågor med svar.
Senaste ändringen i databasen gjordes 2017-07-06 14:08:20.


sök | söktips | Veckans fråga | alla 'Veckans fråga' | ämnen | dokumentation | ställ en fråga
till diskussionsfora

 

Creative Commons License

Denna sida från NRCF är licensierad under Creative Commons:
Erkännande-Ickekommersiell-Inga bearbetningar
.