Söker efter kärnvapen

 

29 frågor/svar hittade

Materiens innersta-Atomer-Kärnor [530]

Fråga:
Finns det ingen risk vid experiment med partikelaccelerator att man skapar en hittills okänd kedjereaktion med katastrofala konsekvenser?
/

Svar:
En kedjereaktion är en serie självförstärkande händelser. I kärnfysik kan neutroner ge upphov till kedjereaktioner när det klyvbara materialet har uppnått kritisk massa. Både kärnvapen och kärnkraftverk är beroende av en kedjereaktion. I fissionsprocessen frigörs c:a 3 neutroner (förutom de två fissionsfragmenten). Om mer är en av dessa neutroner orsakar en ny fission, så kommer antalet kärnklyvningar att öka okontrollerbart (kärnvapen) eller kontrollerbart (kärnkraftverk).

Nej, för partikelacceleratorer är det ingen fara. De förutsättningar som gäller för kedjereaktioner är mycket speciella så att risken för att något sådant ska hända är väldigt liten. En av de som var med och utvecklade atombomben under andra världskriget har berättat för mig att vid ett tillfälle var man orolig för att neutronerna som frigjordes vid bombens explosion skulle starta en kedjereaktion som spred sig i hela atmosfären. En av de teoretiska fysikerna i projektet fick då i uppdrag att undersöka om det fanns en sådan risk. Han räknade i fjorton dagar och kom sen tillbaka och sa: “Nej, det kommer inte att hända“. Det gjorde det inte heller!

Se vidare Chain_reaction .
/Peter E

Nyckelord: fission [15]; kärnvapen [15];

*

Energi [988]

Fråga:
1.Vad är det som händer när ett kärnkraftverk exploderar?

2.Finns det inget annat ämne än uran, som är ofarlig, man kan använda?

3.Vad gör man med bi-produkten (Plutonium?).
/Alexander K, dammfriskolan, malmö

Svar:
1. Ett kärnkraftverk kan inte explodera som ett kärnvapen. Däremot kan man få en härdsmälta. En sådan inträffar om kylningen inte räcker till så att själva härden blir överhettad och smälter. Den kan då skada reaktorinneslutningen samtidigt som det kan ske ångexplosioner. Detta kan ge upphov till att radioaktiva ämnen kan spridas utanför inneslutningen. Det har inträffat två större olyckor med kärnkraftverk. I USA ("Three Mile Island") och i Tjernobyl. I USA så skedde en partiell härdsmälta, det vill säga en del av härden smälte men allt radioaktivt material blev kvar inne i reaktortanken. I Tjernobyl överhettades en del av bränslet och det skedde en ångexplosion och förmodligen också en vätgasexplosion. Dessa "vanliga" explosioner spred ut en stor mängd radioaktivt material.

I Three Mile Island stoppades nästan all radioaktivtet av reaktorinneslutningen, varför inga skador uppkom på omgivningen. I Tjernobyl saknades reaktorinneslutning, och stora mängder radioaktivitet kom ut i omgivningen och spreds med vindar över stora delar av Europa.

2. Det finns några andra ämnen som man kan använda som bränsle i ett kärnkraftverk. Det är inte uranet som är farligt utan de nya ämnen som bildas inne i kärnreaktorn.

3. Man kan antingen upparbeta det och använda det igen i bränslet eller så tar man det till slutförvaring.

Se vidare Chernobyl_disaster , Three_Mile_Island_accident och länk 1.
/GO/lpe

Nyckelord: Tjernobyl [11]; Three Mile Island [2]; kärnkraftsavfall [11];

1 http://news.bbc.co.uk/2/hi/science/nature/5173310.stm

*

Energi [994]

Fråga:
Hur kan det vara skillnad mellan en atombomb och ett kärnkraftverk?
/rickard t, gylleskolan, borlänge

Svar:
Den stora skillnaden är att i atombomben sker kärnreaktionerna mycket snabbt och okontrollerat sedan de satts igång. I kärnkraftverket däremot så sker alla reaktioner långsamt, under kontroll.

För att förklara varför det är så måste vi först kortfattat berätta vad som händer vid de kärnreaktioner som förekommer både i bomben och i kärnkraftverket.

När en urankärna träffas av en neutron så kan den med stor sannolikhet sönderfalla i två nästan lika stora delar. Detta kallas för fission eller kärnklyvning. Sannolikheten för att en neutron ska träffa urankärnan ökar drastiskt om neutronen rör sig sakta. Vid kärnklyvningen sändes det också ut nya, fria neutroner som rör sig snabbt. Dessa kan orsaka nya kärnklyvningar vilket leder till en kedjereaktion.

I kärnvapen ("atombomb") har man en blandning av olika uranatomer som är sådan att kedjereaktionen kan underhållas av de snabba neutronerna. I en kärnreaktor har man en bränslesammansättning som är sådan att de snabba neutronerna inte kan hålla igång en kedjereaktion. Istället har man ett speciellt moderatormaterial (ofta vatten) som bromsar in de snabba neutronerna så att en kedjereaktion både kan hållas igång och kontrolleras.
/GO

Nyckelord: kärnvapen [15];

1 http://sv.wikipedia.org/wiki/K%C3%A4rnvapen

*

Materiens innersta-Atomer-Kärnor [1353]

Fråga:
Jag har till uppgift att skriva lite om antimateria. En av delarna jag ska skriva om omfattar en ev. antimateriabomb. Info om detta är mycket svårt att få tag i, därför vänder jag mig till er. Frågorna är: *Är det praktiskt möjligt att tillverka en sådan bomb? *Vad krävs? *När skulle människan kunna göra det? *Hur många ggr starkare än en "vanlig" atombomb skulle den bli? *Har den några långvariga effekter, typ atombombens strålning? *Hur mycket skulle krävas för att spränga jorden? Har ni övrig info är det jätte-bra...
/Christian A, Kristinaskolan, Angered

Svar:
Det är i praktiken omöjligt att göra en sådan bomb. Den enda sättet att idag tillverka antimateria är i stora partikelacceleratorer, men endast i mycket små mängder.

En sådan hypotetisk bomb skulle bli mycket starkare än ett vanligt kärnvapen, kanske 1000 gånger starkare än en "vanlig" bomb med samma massa.

Det skulle bildas väldigt mycket gammastrålning som säkert skulle producera radioaktiva nuklider nära sprängstället. Dessa nuklider skulle stråla under mycket lång tid.

Det skulle inte finnas någon möjlighet att spränga hela jorden.

  Läs I Forskning och Framsteg nr 3 (april) 1996 (Forskning & Framsteg, webbarkivet )finns en bra artikel om antimateria och de försök som gjorts att framställa denna form av materia.
/GO

*

Blandat [3544]

Fråga:
Kol-14 metoden
/Veckans fråga

Ursprunglig fråga:
Jag skulle vilja veta allt om kol 14-metoden, snarast!!! Tack!
/Pia E, övernäs Högstadieskola,, Mariehamn, Åland

Svar:
Det kol som finns i livet på jorden består av två stabila kärnor (isotoper) med masstalen 12 och 13 (kol 12 och kol 13). Men så finns där en liten mängd radioaktivt kol 14. Det har vi fått i oss från maten, och det kolet kommer ytterst från gröna växter, som i sin tur har tagit upp det från luftens kolsyra.

Högt uppe i atmosfären kommer det in atomkärnor från den kosmiska strålningen med mycket höga energier. De kolliderar med kärnor i luftens kväve och syre. I en del av dessa reaktioner bildas kol 14, som där uppe bildar koldioxid. Den blandas med den icke radioaktiva koldioxiden. Så småningom kommer den ner till jordytan och tas upp av gröna växter.

När vi hugger ner ett träd, dör trädet och slutar ta upp koldioxid. Kol 14 sönderfaller hela tiden, och antalet kol 14-kärnor blir mindre och mindre. Genom att ta reda på hur många kol 14-kärnor där finns, kan man räkna ut hur länge det är sedan trädet fälldes. Det finns två sätt att ta reda på kol 14-halten. Dels kan man mäta radioaktiviteten i kolet, dels kan man köra kolet genom en så kallad masspektrograf och räkna kärnorna.

Kol 14 har en halveringstid på 5730 år, alltså antalet kärnor halveras på denna tid. Det gör att metoden kan användas för datering upp till kanske 30000 år. Arkeologerna har stor glädje av denna metod. Det är inte fullt så enkelt som det låter här, man får göra en del korrektioner, se nedan.

Om förhållandet mellan aktiviteten per gram i ett t år gammalt prov till aktiviteten i ett nytt prov är x gäller att

x = 2 -t /T1/2

dvs

t = - (ln(x)/ln(2))*T1/2 = - (ln(x)/ln(2))*5730 år

Om förhållandet x är t.ex. 1/8 blir alltså åldern

t = - (ln(1/8)/ln(2))*5730 år = 17200 år

Problemet med metoden är att kol-14 halten i atmosfären inte har varit konstant beroende på att jordens magnetfält och därmed den kosmiska strålningen har varierat. I övre figuren nedan visas sambandet mellan apparent ålder på y-axeln och den verkliga dateringen på x-axeln, se Radiocarbon_dating för detaljer.

Kärnvapenproven under 50-60-talet har även komplicerat dateringar av prover från denna tidpunkt och framåt. I den nedre figuren kan man se att halten kol-14 nästan fördubblats 1963. Observera att den snabba minskningen när de atmosfäriska bombproven avslutades i mitten av 60-talet inte beror på radioaktivt sönderfall utan att C-14 från atmosfären binds i växter och djur och till sist i jordskorpan.

Bilderna är från Wikimedia Commons (public domain).

Mera information får du om du slår på datering i Nationalencyklopedin och i Wikipedia-artikeln Carbon-14 . Se även länk 1 nedan.



/KS/lpe

Se även fråga 886 och fråga 1043

Nyckelord: radioaktiv datering [7]; kol-14 metoden [4];

1 http://hyperphysics.phy-astr.gsu.edu/hbase/nuclear/cardat.html#c1

*

Blandat [8935]

Fråga:
Vad skulle hända om man skickade ut allt kärnavfall och alla kärnvapen ut i rymden?
/Pelle R, Nya påvelund , Göteborg

Svar:
Att skicka ut kärnavfall utanför solsystemet skulle vara ett sätt att definitivt bli av med det. Man kan också tänka sig att skicka in det i solen. Att bara skicka det i en bana kring solen är ingen bra lösning. Det är stor risk att det kommer ramla ner här igen.

Det är två problem med denna idé. Dels är det dyrt, dels finns en risk att raketutskjutningen misslyckas, med förfärliga följder.
/KS

*

Materiens innersta-Atomer-Kärnor [13570]

Fråga:
Vi ska ha en debatt i skolan och jag skulle behöva få reda på vilka positiva (ren fysik inte etik och moral) saker det finns med att tillverka/användning av kärnvapen.
/Edina k, trollboda skolan, hässelby

Svar:
Edina! När det gäller kärnvapen är det svårt att bortse från etik och moral. Det enda positiva är att kärnvapen är så förfärliga att de är omöjliga att använda i krig. De har visserligen använts en gång (Japan 1945), men de flesta anser i dag att detta inte var nödvändigt. Tack vare terrorbalansen (MAD = Mutual Assured Destruction, ömsesidig säker förstörelse) undveks en väpnad konfrontation mella NATO och Sovjetunionen under det s.k. kalla kriget.

Kän man använda kärnvapen till något bra? Mja, man har tänkt sig små kärnexplosioner för att driva fram en raket ute i rymden. Projektet las emellertid ner. Man har använt kärnvapen för studier av atomkärnor, men det är dyrt och krångligt, speciellt som detektorerna förstördes på mindre än en sekund!

Det har kommit upp ett par filmer om hur man räddar jorden från en kollision med småplaneter/kometer (t.ex. Deep Impact) med hjälp av kärnladdningar. Realismen i detta betvivlar jag dock, framför allt för att tiden från upptäckt till kollision är för kort.

Viktigast är säkert att genom utvecklingen av kärnvapen så lärde vi oss mycket om atomkärnan och den enorma energi som finns tillgänglig i tunga (genom fission) och lätta (genom fusion) kärnor. Kärnkraftverk utvecklades och ger fortfarande ett stort bidrag till vår energiförsörjning utan produktion av CO2.

Slå upp de kursiva orden i Nationalencyklopedin . Se även nedanstående länk.
/Peter E

Nyckelord: kärnvapen [15];

Avancerad sökning på 'kärnvapen' i denna databas

*

Blandat [12009]

Fråga:
Jag gör ett arbete om kärnvapen på fysiken. Och i min information står det att om den kritiska massan är över 100kt så riskeras för snabb sprängning. Men vilken är den minsta möjliga massa för en explosion.
/Micael M, Fågelbäcksskolan, Trelleborg

Svar:
Med kritisk massa menas vanligen den minsta mängden av uran eller plutonium som behövs för att starta en kedjereaktion. Det rör sig om ungefär 10 kg, se Critical_mass för exakt information. Urans densitet är ungefär 20 gånger vattnets, så det blir alltså ungefär ½ liter.

En kärnladdning kan konstrueras så att sprängkraften blir mindre än 1 kt.

Se länk 1 för mer information (på engelska) om kärnvapen. Kärnvapen är information på svenska.

Nedanstående bild är från Critical_mass .

Figurtext:
As part of a re-creation of a 1945 criticality accident (Criticality_accident#Incidents ), a plutonium pit is surrounded by blocks of neutron-reflective tungsten carbide. The original experiment was designed to measure the radiation produced when an extra block was added. Instead, the mass went supercritical when the block was placed improperly by being dropped.


/KS/lpe

Nyckelord: kärnvapen [15];

1 http://science.howstuffworks.com/nuclear-bomb.htm

*

Materiens innersta-Atomer-Kärnor [12842]

Fråga:
Hejsan! Jag har några frågor om radioaktivitet till er här på fysiken, som jag inte har fått bukt med än och hoppas att ni kan hjälpa mig med...

1) Hur kan radioaktiviteten påverka oss människor på både positiva och negativa sätt?

2) Vilken strålning är farligast? (alfa, beta eller gamma?)
/Mattias E, Samskolan, Göteborg

Svar:
Mattias!

Joniserande strålning (Joniserande_strålning ) är ett samlingsbegrepp på strålning som har förmågan att slå ut elektroner ur atomer som den kolliderar med, vilket förvandlar atomerna till joner. Joniserande strålning kan antingen vara elektromagnetisk strålning (ultraviolett, röntgen-, och gammastrålning) eller partikelstrålning (energirika elektroner, protoner med mera som har en energi på några elektronvolt).

Din första fråga är inte så lätt att svara kort på... Först och främst måste man skilja mellan naturligt förekommande radioaktivitet och den som är skapad av oss människor. Man måste också noga skilja på radioaktiviteten i sig, som ju har med atomkärnors sönderfall att göra, och på verkan av den joniserande strålning (alfa, beta och gamma) som sänds ut i samband med sönderfallen.

Det finns många sätt att utnyttja radioaktivitet och strålning - t.ex. inom geologi, arkeologi och klimatforskning (kol-14-datering, spårämnesstudier), medicin (cancerbehandling, PET-kamera) och industrin (tjockleks- och nivåmätning, förslitningsstudier). Gemensamt för dessa är att det är relativt lätt att detektera även mycket små mängder av radioaktiva ämnen, och att man därför kan få mycket information på ett (oftast) icke-förstörande sätt.

Negativt är dock att den joniserande strålningen kan skada materia av alla slag, även människokroppen. Därför är t.ex. radioaktivt nedfall från kärnvapentest och kärnkraftverksolyckor, men även radon (som ju förekommer helt naturligt) så farliga.

Din andra fråga är inte heller lätt att svara på. Av de tre alternativen du nämner gör alfastrålningen mest skada när den tränger in i vävnad - den åstadkommer helt enkelt mer jonisation per längdenhet än de andra. Det är dock den strålart som det är enklast att skydda sig i från, eftersom den kan stoppas mycket effektivt även i tunna materieskikt, se bilden nedan (från Nationalencyklopedin ). Det bästa strålskyddet är emellertid alltid att vara på stort avstånd från strålkällor.

Läs vidare: Slå upp "joniserande strålning" och "radioaktivitet" i Nationalencyklopedin och länk 1 och 2!



/Margareta H/lpe

Nyckelord: joniserande strålning [4]; radon [4]; naturlig radioaktivitet [3]; strålning, faror med [24]; radioaktivt sönderfall [35];

1 http://www.stralsakerhetsmyndigheten.se/Allmanhet/Radon/Radonkallor/
2 http://science.howstuffworks.com/radon.htm/printable

*

Materiens innersta-Atomer-Kärnor [12960]

Fråga:
Hej, jag håller på med mitt projektarbete som handlar om kärnfysik och energiutvinning. Jag har några frågor. Idag har vi ju ännu inte något elproducerande fusionskraftverk och jag undrar hur ett sådant skulle kunna se ut i framtiden?. I ett kärnkraftsverk så värmer man ju upp vatten genom klyvning som senare går genom en turbin och till en generator och då har man ström. Vattnet fungerar ju också som moderator och dämpar strålningen i ett kärnkraftsverk. Men i ett framtida fusionskraftverk skulle väl inte vatten vara av samma betydelse?

Borde man inte i ett framtida fusionskraftverk kunna omvandla energin från fusionen direkt till elektrisk energi via generator istället för att gå omvägen via vatten och en turbin. Eller måste man värma upp vatten och gå den vägen för att kunna tillgodogöra sig fusionsenergin?

Jag har en annan fråga också och undrar hur spontan fission i naturen fungerar. Skulle det inte kunna uppstå en kedjereaktion typ som i en atombomb?
/Adam Ö, Falu frigymnasium, Falun

Svar:
Standardkonstruktionen på en fusionsreaktor är en torusformad (bilringsformad) inneslutning med ett magnetfält. De laddade partiklarna i den heta plasman kommer alltså inte åt röret som bildar torusen. Neutronerna kan däremot ta sig ut, och det är dessa som kan transportera energin ut från reaktorn.

Man har lyckats med vad som kallas "theoretical break even" i JET, EFDA-JET . Detta innebär att man fått ut lika mycket energi som man satt in (lika mycket energi kommer ut från fusionen som man sätter in för att värma plasman). Problemet är att energin finns i form av neutroner med hög energi, och problemet man skall lösa med nästa generation fusionsreaktor (ITER, EFDA , se nedanstående bild) är att ta vara på den energin. Hur detta skall ske och vilka material man skall använda vet man inte ännu. Se ovanstående länkar, Fusion_power och nedanstående sökning för mer information om fusion.

Det fordras mycket speciella förhållanden för att en kedjereaktion skall vara möjlig. Man har hittat plutonium i en uran-gruva i Afrika (Oklo, Gabon), och eftersom plutonium är ganska kortlivat har plutoniet antagligen bildats i en naturlig reaktor, se En naturlig kärnreaktor: Oklo och Natural_nuclear_fission_reactor . Naturligt uran innehåller bara 0.7% av den klyvbara U-235, så naturliga kedjereaktioner är mycket ovanliga.

I en vanlig lättvattenreaktor har man 3-5% U-235. Det är då precis möjligt att vidmakthålla en kedjereaktion. För ett kärnvapen behöver man nära 100% U-235, så en atombomb kan inte uppstå naturligt.



/Peter E

Nyckelord: fusion [15]; fission [15];

Avancerad sökning på 'fusion' i denna databas

*

Blandat [13095]

Fråga:
Hur fungerar en EMP puls bomb?
/christopher h, friberga, danderyd

Svar:
EMP står för ElectroMagnetic Pulse. Det är inte så lätt att förklara hur EMP fungerar utan att man känner till hur kärnvapen fungerar:

Kärnexplosionen ger upphov till gammastrålning. Denna träffar elektroner i atmosfären, så att dessa med compton-spridning får en rörelseenergi. Elektriska laddningar som rör sig ger upphov till varierande elektriska och magnetiska fält, dvs elektromagnetisk strålning. Det är denna (som ligger i radio-mikrovågsområdet) som inducerar stömmar i elektronik och därmed förstör den.

För mer detaljer se Electromagnetic_pulse och nedanstående länkar. En EMP bomb är ett kärnvapen där man genom konstruktionen och användning optimerat så att de huvudsakliga skadorna uppkommer pga EMP. Ursäkta att det blev så tekniskt, men det är inte så lätt!
/Peter E

Nyckelord: kärnvapen [15];

1 http://science.howstuffworks.com/e-bomb.htm
2 http://www.fas.org/spp/starwars/congress/1997_h/h970716u.htm

*

Materiens innersta-Atomer-Kärnor [13157]

Fråga:
Jag håller på och undersöker lite saker om atombomben och undrar följande: Hur får man den att detonera exakt? Vad är det som sker där? Är det så att man tillför en neutron till ett kilo uran, eller hur går det till egentligen? I sådana fall, hur tillför man neutronen?

Sedan har jag även en kompis som undrar hur själva bomben ser ut, alltså rent estetiskt.
/Mikaela L, Den seglande gymnasieskolan, Öckerö

Svar:
Man använder en liten accelerator (detonator) som producerar neutroner i rätt ögonblick. Slå på kärnvapen i Nationalencyklopedin och läs nedanstående frågor.

Den andra frågan förstår jag inte.
/Peter E

Avancerad sökning på 'kärnvapen' i denna databas

*

Materiens innersta-Atomer-Kärnor [13679]

Fråga:
Verkan av kärnvapen
/Veckans fråga

Ursprunglig fråga:
Hur länge var marken radioaktiv i Hiroshima och Nagasaki efter atombombningarna? Hur går man till väga vid en strålningskatastrof, finns det något sätt att få bort strålningen ur marken?
/Jesper E, Karro, Örebro

Svar:
Kärnvapen är en benämning för olika typer av vapen vars sprängladdning får sin energi från fission eller från olika kombinationer av fission och fusion, till skillnad mot konventionella vapen vars sprängladdningar får sin energi från kemiska processer, se Kärnvapen .

Man kan inte svara exakt på den första frågan: det bildas nuklider med både kort och mycket lång halveringstid. Efter något år är nvåerna nere till i storleksordningen den naturliga bakgrundsstrålningen, men med känsliga detektorer kan man detektera strålning som härrör från ett kärnvapen under mycket lång tid. Efter 6 dagar uppskattar man att endast 10% av radioaktiviteten fanns kvar.

Det är svårt att sanera ett område som blivit kontaminerat av radioaktivt material. Radioaktivt nedfall kan man i princip få bort genom tvättning och bortforslande av det översta jordlagret. Inducerad radioaktivitet (se nedan) är nästan omöjligt att göra något åt såvida man inte forslar bort precis allt.

Låt oss passa på och gå igenom de verkningar man får av ett kärnvapen:

Tryckvåg

Den kraftiga explosionen skaper en tryckvåg som gör mycket stor skada. Än värre blir skadan eftersom den första tryckvågen utåt följs av en nästan lika kraftig inåt. Den senare skapas av det undertryck som uppstår när luften värms upp och därmed stiger.

Värmestrålning

Värmestrålning från det upphettade plasmat som bildas av explosionen. Värmestrålningen sätter eld på allt brännbart nära explosionsplatsen. För mycket stora kärnvapen (vätebomber) är värmestrålning den dominerande skadeverkan.

Omedelbar joniserande strålning

I fissionsprocessen (klyvning av tunga atomkärnor) bildas neutroner och gamma/röntgenstrålning. En del av neutronerna (det bildas 2-3 per kärnklyvning) går åt till att hålla kärnklyvningen vid liv (drygt 1 neutron), medan resten flyger ut med hög hastighet till dom träffar något, se inducerad radioaktivitet.

Denna omedelbara strålning ger en skadlig stråldos dos till den som befinner sig nära. För små kärnvapen är detta den dominerande skadeverkan (neutronbomber).

Elektromagnetisk puls

Elektromagnetisk strålning som inducerar stömmar i ledningar och förstör elektronik. För detaljer se fråga 13095 nedan.

Radioaktivt nerfall

De som ger energin till explosionen är ett snabbs förlopp (kedjereaktion) av klyvning av 235U eller 239Pu. Klyvningen induceras av neutroner som bildats i en tidigare kärnklyvning. Resultatet av kärnklyvningen (fission) är två medeltunga kärnor (kallade klyvningsprodukter), 2-3 neutroner och mycket energi. Klyvningsprodukterna är oftast radioaktiva, och de faller ner efter ett tag och utgör en fara för omgivningen - framför allt i vindriktningen.

Inducerad radioaktivitet

De neutroner som kommer ut vid explosionen träffar meterial på marken och kan förorsaka kärnreaktioner i detta. Material i omgivningen kan då bli radioaktivt. Denna aktivering av omgivningen har i Hiroshima och Nagasaki använts för att bestämma hur hög stråldos personer på olika platser utsatts för. Denna kunskap, tillsammans med statistik på sena skador (mest cancer) har givit oss goda kunskaper om skadeverningarna av joniserande strålning, åtminstone var gäller relativt höga doser.

Hur länge finns risker?

Varför kunde man då mycket kort efter bomberna i Hirishima och Nagasaki flytta tillbaka, medan Tjernobyl fortfarande är alldeles för kontaminerat för att man skall kunna vistas där? Skillnaden är dels att det kom ut mycket större mängd (i ett kärnvapen finns några tiotals kg klyvbart material, i ett kärnkraftverk hundratals ton) klyvningsprodukter i Tjernobyl och de var i medeltal mer långlivade. I ett kärnvapen produceras klyvningsprodukter under en mycket kort tid, och ganska få av dessa är långlivade. I ett kärnkraftverk pågår kärnklyvningen under lång tid, varvid de långlivade nukliderna finns kvar medan de kortlivade sönderfaller.

Se vidare länk 1 och länk 2 under 'Hiroshima and Nagasaki Health Effects'. Nuclearfiles.org innehåller mycket information om kärnvapen. Bilden nedan kommer från denna sajt.



/Peter E

Se även fråga 13095

Nyckelord: kärnvapen [15]; Tjernobyl [11]; Hiroshima/Nagasaki [4];

1 http://www.hindu.com/thehindu/2001/09/06/stories/08060003.htm
2 http://hps.org/publicinformation/ate/cat25.html#141

*

Blandat [13720]

Fråga:
Vad är jämförelsen mellan dagens genteknik och äldre tiders växtförädling och djuravel?
/Veckans fråga

Ursprunglig fråga:
Vad är jämförelsen mellan dagens genteknik och äldre tiders växtförädling och djuravel?
/linda s, tråsätra, åkersberga

Svar:
Hej Linda! Jag tackar för du ger mig chansen att skriva om ett ämne som ligger väl utanför mitt kompetensområde, men som trots det (eller kanske just därför) intresserat mig länge. Rebecca Brudefors, Österåker ställde ett antal frågor om liknande ämnen. För er båda vill jag rekommendera att ni börjar med att läsa i Nationalencyklopedin och en modern biologibok. Biology Animation Library är också en mycket bra (men ganska avancerad) resurs med bland annat animeringar som förklarar olika metoder inom gentekniken. Den nya biologin är också användbar.

Fysiker kan naturligtvis förklara nästan allting , men när det gäller genteknik är jag alltså amatör. Men lite synpunkter kan jag ha - helt och hållet mina privata sådana!

Vad är genteknik?

Genteknik (eller det negativa namnet genmanipulation) är en relativt ny teknik som innebär att man med tekniska, artificiella medel ändrar i arvsanlagen. Det kan vara från att få en gröda att tåla ogräsgiftet Roundup så man kan bli av med allt ogräs till att få fram en kalv med två huvuden. Arvsanlagen ligger i vad man kallar DNA. Bilden nedan visar en liten del av en DNA-dubbelspiral. Genteknik går till så att man byter ut en bit DNA mot en annan bit DNA, där den nya biten ger andra egenskaper. Hur man klipper och klistrar (transformation) på det här sättet och hur man vet vilka delar man skall byta ut (mappning) kan vi inte gå in på här, det finns mer information på BIONET, länk 2 under 'Hur händer det?'.

Med traditionella metoder (växtförädling/djuravel, se nedan) kan egenskaper bara överföras mellan samma art eller nära besläktade arter. I genetisk modifiering kan egenskaper överföras från en art till en helt annan, och till och med mellan växter och djur. Detta är tveklöst en orsak att genteknik och växtförädling/djuravel i allmänhet uppfattas så olika.

Växtförädling/djuravel och urval

är en sedan lång tid etablerad metod att få fram bättre skördar och mer lämpade djur. Det bygger på de naturliga förändringar (mutationer) som sker i arvsanlagen hela tiden hos alla organismer. Den utveckling som skett av livet under nästan 4 miljarder år från mycket enkla encelliga organismer till (som vi tycker själva kronan på verket) människan, har drivits fram av dessa naturliga mutationer och det naturliga urvalet.

Det naturliga urvalet var en teori som Charles Darwin efter mycket omfattande studier lade fram i sin bok On the Origin of Species (först publicerad 1859). Resten av boktiteln 'by Means of Natural Selection, or The Preservation of Favoured Races in the Struggle for Life' beskriver teorin mycket väl: av de olika mutationer som kommer fram hela tiden kommer i medeltal de som är bäst lämpade för överlevnad och reproduktion att föröka sig. Man får alltså en långsam utveckling mot mer sofistikerade (i motsats till primitiva) och till omgivningen anpassade arter. Detta är Darwins evolutionsteori. Observera att Darwin inte kände till gener och DNA, så han kunde inte i detalj beskriva hur mutationer och arvet gick till.

Växtförädling/djuravel (traditionell sortförbättring) utnyttjar dessa naturliga mutationer, men människan hjälper naturen på traven genom att göra urvalet. Man väljer alltså t.ex. att låta säd med kort stam eller de största biffkorna föröka sig. Man kan även välja att korsa individer med olika egenskaper för att på så sätt få nya egenskaper - hundraser är ett exempel på detta. Detta artificiella (konstgjorda, i motsats till det naturliga) urval gör att man når resultat mycket snabbare - faktiskt bara efter några generationer. För att ytterligare snabba på processen kan man öka mutationsfrekvensen med hjälp av strålning eller kemikalier.

Kloning

Man kan till gentekniken även inkludera s.k. kloning, där man tar ut DNA-uppsättningen från en organism och sätter in den i ett växande ägg i en annan. Man får då (genetiskt i varje fall) en exakt kopia av urspungsorganismen. Kloning är, tycker jag, tveksam när det gäller högtstående djur och helt förkastligt när det gäller människor.

Kartläggning av gener

Man har nu lyckats kartlägga människans arvsmassa som består av c:a 3 miljarder bitar (molekyler, ACG och T, markerade med de fyra olika färgerna i figuren nedan). All information om detta 'Human Genome Project' finns under länk 1. Så här ser en liten slumpmässigt vald del ut:

CTTAAAAAATTTGTTTTATGCAGCTCAGCAAAGTATTTTTCCTATTAGTTGTGAAACAAATACATGTGTA
GTTAAAACTGGTTGAAATGACATACCTCATATCTCTGGTAAACCTGTACTATTCTCTAAACCTGTGTAAG
GAGATCACATTGAGAAATTACACATGTATCCTAACATTTTTTTTAAAGTCTTTTTGTGAGAACATTTTAT
TTATGGTATTCTCGGTGAAAGTCAGTCTTTTGTAGGGGTGAATAAGACTTTTGAAAATAACCTCCTCAAA
AAGCTACTAAGAACATATTGTTGACTAATTTAGATTATCCTGTTTGCAGTGGCAGATTATGATGATAGCC
CAGTGAGACTGACTTTGAAACTTGATTCAAACTGTCCCTAGGGATAATTCAGACCTTTCTGTAGTAAACA
TTTCTGGTTTTTTTTTTTTTTTTTTTTTTTTTGCTAAATCCTCTTTTTTTTCCTCCTATAAGTCCACTTG
Kartläggningen hyllades för några år sedan med en TV-sändning som en fantastisk prestation (som en månlandning) med president Clinton, Tony Blair från Storbritanien, men i själva verket var det bara relativt trivialt arbete att fastställa sekvenserna. En helt annan sak är att verkligen tyda koden och förstå vad olika sekvenser betyder i termer av egenskaper. Vi är mycket långt från detta ännu.

Vad som däremot har kommit fram genom studerandet av DNA-sekvenser är släktskapet mellan olika organismer. Med klassisk biologi kunde man genom att jämföra olika egenskaper (t.ex. antal tår) få fram ett släktträd som var rimligt väl etablerat. Med DNA-teknik har släktträdet blivit mycket säkrare (se t.ex. den mycket fascinerande boken The Ancestor's Tale av Richard Dawkins). Man använder för detta framför allt de 97% av arvsmassan som inte tycks ha någon uppgift. Denna del av DNA kallas "Junk-DNA", dvs skräp-DNA.

Är genteknik farlig eller skadlig på annat sätt?

Att äta genmanipulerad majs är antagligen inte farligt (vi vet egentligen inte vilka risker som är förknippade med genetisk modifiering av livsmedel), men om majsen sprutats med växtgifter kan det naturligtvis vara skadligt.

Man skulle kunna åstadkomma t.ex. en växt som själv producerar ett gift mot skadeinsekter. Att äta denna växt skulle kunna vara skadligt.

Om bonden i ett fattigt land inte får använda en del av skörden till nästa års utsäde utan att betala det multinationella bolaget en massa pengar han inte har (därför att generna är patenterade av bolaget) är naturligtvis helt förkastligt.

Det finns enligt min åsikt ett antal problem med gentekniken som gör att man kan behöva lagstifta.

  • Oetisk förändring av egenskaperna hos djur och människor (här är boskapsrasen Belgian Blue ett exempel där även klassisk djuravel kan vara oetisk)
  • Kloning av högre djur och människa
  • Vågar vi ta risken att använda genetisk modifiering av livsmedel när vi ännu inte känner till långtidseffekterna?
  • Patent på gener
  • Framställning av skadliga organismer som t.ex. slår ut andra
  • ....
Kärnfysiker har länge fått bära hundhuvudet för konstruktionen av kärnvapen, men vi har försvarat oss med att man kan inte stoppa ökad kunskap, och att ansvaret för att kärnvapen använts är politikernas.

Vi måste agera på samma sätt vad gäller genteknik: tillåt forskning som är etiskt försvarbar med förbjud oetiska och skadliga tillämpningar. Att förbjuda gentekniska tillämpningar är emellertid svårare än att hindra att kärnvapen används, eftersom det faktiskt är betydligt lättare (kräver mindre svåråtkomlig utrustning) att tillämpa genteknik än att bygga ett kärnvapen.

*

Ursäkta att det bitvis blev lite tekniskt för grundskolestadiet, men ni kan kanske ha svaret som en grund att fortsätta studier i detta utomordentligt intressanta ämne! Det är dessutom en ämne som lämpar sig mycket bra för diskussion om moraliska och etiska problem. Länk 2 ger en startpunkt.



/Peter E

Nyckelord: genteknik [2]; Darwins evolutionsteori [8]; *biologi [20];

1 http://www.ornl.gov/sci/techresources/Human_Genome/home.shtml
2 http://www.bionetonline.org/svenska/Content/ff_eth.htm

*

Materiens innersta-Atomer-Kärnor [14954]

Fråga:
Hej jag funderar väldigt mycket på kärnkraft och kärnvapen. Min fråga är används uran till båda delarna och är det uranet som är farligt.
/Robin P, Centralskolan, Åtvidaberg

Svar:
Hej Robin! Du frågar om något som inte är lätt att förstå utan en ordentlig bakgrund i fysik. Ja, både kärnkraft och kärnvapen använder uran, men en sällsynt variant som heter uran-235. Bortsett från att båda använder uran är tekniken mycket olika för ett kärnkraftverk och ett kärnvapen.

Från naturligt uran som innehåller 0.7% uran-235 kan man separera ut uran-235 så man får 3-5%. Detta kan användas som bränsle i kärnkraftverk. Om man vill göra kärnvapen måste man separera ut uran-235 till över 90%. Detta är mycket svårare eftersom det kräver en mycket stor anläggning.

Uran som sådant är inte särskilt farligt, men eftersom man när man klyver en urankärna får ut väldigt mycket energi och strålning, gäller det att inte vara i närheten!
/Peter E

Nyckelord: kärnenergi [18]; kärnvapen [15];

1 http://www.svenskenergi.se/energifakta/karnkraft.htm
2 http://sv.wikipedia.org/wiki/K%C3%A4rnvapen

*

Materiens innersta-Atomer-Kärnor [15030]

Fråga:
Hej! 1. Vad är farligast: en lång eller kort halveringstid? En kort halveringstid borde väl innebära att den instabila isotopen snabbare blir en stabil, men samtidigt sänder den ut en större strålmängd under kortare tid? 2. Varför gills plutonium som extra farligt reaktoravfall?
/Susanna I, Kärrtorp, Stureby

Svar:
Hej Susanna!

1 Beror på omständigheterna. Om vi har ett givet antal atomer så ger kort halveringstid en högre aktivitet, så på kort sikt är det farligare. Lång halveringstid ger lägre aktivitet, men aktiviteten varar i stället längre. När det gäller kärnavfall från en reaktor är det lätt att eliminera de kortlivade isotoperna - det är bara att vänta ett tag. Man tar t.ex. inte ut bränsleelement direkt från reaktorhärden - de får ligga ett tag i en vattenbassäng.

2 Tre skäl: Plutonium är långlivat och därför skadligt under längre tid än vi kan överblicka. Plutonium är kemiskt giftigt. Man kan göra kärnvapen av plutonium.
/Peter E

*

Värme [16450]

Fråga:
Hur ser en explosion ut rymden? jag vet att det inte skulle låta något. Men skulle man se någon eld. För eld behöver ju syre.
/johanna l, vinstagårdsskolan, hässelby

Svar:
Johanna! Syret gör ingen skillnad. En explosion orsakas av en mycket snabb (normalt) kemisk reaktion. Allt som behövs finns redan i sprängladdningen. Om det behövs finns alltså redan oxidationsmedlet i laddningen.

Det som gör skillnad är att i rymden saknas luft och tyngdkraft. Vid en explosion på jorden hindras de snabbt expanderande gaserna av luften. I rymden sker expansionen obehindrat. En annan skillnad är att man vid en stor explosion på jorden får ett svampmoln. Detta orsakas av att den varma gasen har lägre densitet är atmosfären, så den stiger. Efter ett tag har temperaturen sjunkit och det omgivande lufttrycket är lägre. Explosionsgasen slutar stiga och sprider sig åt sidorna. Detta svampmoln är typiskt för kärnvapen , men det förekommer även vid andra stora explosioner.

Så den största skillnaden i rymden är en snabbare, mer obehindrad expansion som är ganska symmetrisk (lika i alla riktningar). Skadan från utkastad gas och splitter kan alltså vara över ett större område i rymden än på jorden. Det du kallar eld är varm, delvis joniserad gas (plasma) som man alltid får av gas vid mycket höga temperaturer.
/Peter E

Se även fråga 9071

*

Elektricitet-Magnetism [16812]

Fråga:
Hej, jag och ett par kompisar ska försöka bygga en elektromagnetisk pulsgenerator till vårt projektarbete. Och vi har ett antal frågor angående detta: 1. Hur uppstår det magnetiska fält runt elektriska kretsar? 2. Vad är själva "pulsen" som vi ska generera? 3. Vilken är vår viktigaste komponent så att säga, ska vi ha mycket spänning, hög ström eller vadå?
/Ivan C, Njudungdgymnasiet, Vetlanda

Svar:
Ivan! Jag tycker inte detta låter som en bra idé, det låter svårt och kanske farligt. En elektromagnetisk puls (EMP) uppkommer normalt från kärnvapen på hög höjd, se fråga 13095 nedan. Det finns andra tekniker, men de är betydligt svagare, se t.ex Electromagnetic_pulse#Non-nuclear_electromagnetic_pulse .
/Peter E

Se även fråga 13095

*

Materiens innersta-Atomer-Kärnor [17802]

Fråga:
Hej! Jag undrar om man kan veta om en blandning av radioaktiva Cs-isotoper kommer från reaktordrift eller ett kärnvapenprov?
/zandra K, Adolfsbergsskolan, Örebro

Svar:
Zandra! Är du inte lite ung för att fundera på sånt här ?

Vad gäller Cs-isotoperna så produceras 134Cs mycket lite direkt vid fission/betasönderfall (Eftersom 134Xe är stabilt) utan det produceras genom långsam neutronaktivering av den stabila isotopen 133Cs. 134Cs finns därför mycket lite av efter ett kärnvapenprov, se Nuclear_fission_product#Fission_products_in_nuclear_weapons .

När det gäller andra isotoper har man typiskt mer långlivade i avfall från kärnkraftverk eftersom de kunnat byggas upp under längre tid.
/Peter E

Nyckelord: kärnvapen [15]; kärnkraftsavfall [11];

*

Materiens innersta-Atomer-Kärnor [18153]

Fråga:
Vi har precis kommit igång med atom och kärnkraft i årskurs 9 och pratade om fission idag. Frågan kom från en elev och jag kunde inte ge något svar som jag själv blev nöjd med.

Varifrån kommer den första neutronen in i kedjereaktionen ifrån?

Jag har alltid tänkt att det är ett planerat sönderfall av något ämne och en sökning gav svaret att det är en partikelaccelerator som också kan sätta fart på fissionen. Stämmer detta?

Finns det något relativt enkelt sätt att förklara en partikelaccelerator för en vetgirig åk 9?
/Petri M, Mariefreds skola, Mariefred

Svar:
Det finns alltid lite neutroner i en kärnreaktor eftersom både U-235 och U-238 har en liten sannolikhet att sönderfalla genom spontan fission, se fråga 16986 .

Även om en reaktor skulle kunna startas med neutronerna från spontan fission så använder man speciella strålkällor för neutroner. Speciellt för kärnvapen där det är viktigt att kedjereaktionen startar i exakt rätt ögonblick måste man ha en neutronkälla i form av en mycket kompakt accelerator som producerar neutroner med en kärnreaktion.

I en reaktor använder man normalt radioaktiva neutronkällor som Cf-252 (spontan fission) eller alfa-strålare+beryllium som utnyttjar reaktionen mellan en alfapartikel från alfasönderfall med beryllium:

a + 9Be --> 3a + n

Se vidare Startup_neutron_source och Neutron_source .

Det skulle föra för långt att beskriva olika typer av partikelacceleratorer. Particle_accelerator är en bra utgångspunkt. De enklaste, och äldsta, är elektrostatiska acceleratorer som i princip består av en jonkälla för positiva joner, ett evakuerat accelerationsrör och ett spänningsfall till jord, se nedanstående bild från Wikimedia Commons.



/Peter E

Nyckelord: kärnenergi [18]; kärnvapen [15]; fission [15]; accelerator [7];

1 http://science.howstuffworks.com/transport/engines-equipment/vdg3.htm

*

Materiens innersta-Atomer-Kärnor [18306]

Fråga:
Vad är det farligaste med kärnkraftverk? Till exempel, uranbrytning. Tack på förhand!
/leonard B, Kunskapsgymnasiet, Uppsala

Svar:
Det är omöjligt att svara på frågan utan att specificera vad man menar med farligt. De fyra viktigaste potentiella problemen är

1 Avfallsproblemet, se fråga 1351 .

2 Haveririsken, se fråga 1351 .

3 Risker vid uranbrytning, se Uranium_mining .

4 Risk för kärnvapenspridning, se Nuclear_proliferation .
/Peter E

Nyckelord: kärnenergi [18];

*

Materiens innersta-Atomer-Kärnor [18348]

Fråga:
Hej! vi pluggar just nu kärnfysik och jag har en fråga. På vårt målpapper står det så här: För att nå ett högre betyg ska eleven ha djupare kunskaper om de olika punkterna i kärnfysik samt att kunna sätte in dem i ett sammanhang/ historiskt perspektiv och dra egna slutsatser kring ett problem. Hur skulle jag kunna väva in till exempel miljöpåverkan i ett historiskt perspektiv? Jag skulle kunna nämna tjernobyl, hiroshima och nagasaki tillexempel. Men jag har problem med ta egna slutsatser och problematisera. Tacksam för hjälp
/Cecilia B, Kulturama, Sundbyberg

Svar:
Hej Cecilia! Om man ser kärnklyvning generellt kan du även ta med det atmosfäriska kärnvapentesterna som gjordes på 50-60 talen (Nuclear_fallout , Nuclear_weapons_testing ). Kärnvapen kommer in både under miljöpåverkan och under historia. Annars är det klart att du skall ta upp de problem som finns med kärnenergi: olycksrisk och avfallet. Kanske också att det finns idéer hur man skall undvika problemen, se fråga 1351 . Uranbrytning kan också vara en hälsofara för gruvarbetarna, se fråga 18306 .

Sedan måste du balansera problematiseringen genom att även ta upp positiva sidor med kärnenergi, t.ex. att den inte orsakar några koldioxidutsläpp:

Här är tidigare svar du kan botanisera bland:

kärnenergi
kärnkraftsavfall
fission
kärnvapen
/Peter E

*

Materiens innersta-Atomer-Kärnor [18770]

Fråga:
Jag fick höra att i stort sett hela energin vid en atombombsexplosion blir gammastrålning i första steget. Jag undrar hur atombombsexplosionen skapar tryckvågen när den exploderar i atmosfären ? alltså hur den frigjorda energin ger upphov till värme, strålning, tryck.

Fick höra att vid en atombombsexplosion under marken bildas ingen tryckvåg pga det finns ingen luft. Det bildas ett hålrum pga den enorma hettan har smält berget. Mvh Tomas
/Tomas J, Tychobraheskolan, Helsingborg

Svar:
Nej, det är inte så. En mycket stor del av den tillgängliga energin (c:a 200 MeV per fission) utgörs av fissionsfragmentens rörelseenergi. En mindre del kommer i form av snabba neutroner, gamma från fissionsprocessen (prompt gamma-rays) och fördröjda beta/gamma-sönderfall av restkärnorna. Det utvecklas alltså mycket energi nära explosionen, och den höga temperaturen orsakar en tryckhöjning.

För en underjordisk explosion går den mesta energin till att generera seismiska vågor och en mindre del för att förånga/smälta och komprimera marken omkring explosionen, se Underground_nuclear_testing#Effects .

Se fråga 13679 för mer om kärnvapens verkan och kärnvapen för mer om kärnvapen.
/Peter E

Nyckelord: kärnvapen [15];

*

Materiens innersta-Atomer-Kärnor [18929]

Fråga:
När en fusions/fissions bomb detonerar gör den ju sig beroende av sin omgivning. Ju mer massa som omringar den desto "bättre" effekt. Så vitt jag vet består inte rymden av mer än plasma gas och mörk materia/energi.

Detta bör då rimligtvis innebära att en vätebomb som detonerar i rymden får "sämre" effekt än på land. Men hur mycket förändras tryckvågen i rymden kontra land. Om vi utgår ifrån att en vätebomb detonerars bestående av 1kiloton sprängmedel(ca.140m tryckvåg på land)?
/Hampus O, Göteborg

Svar:
Det är mycket komplicerat att beräkna effekten av ett kärnvapen - man använder mycket sofistikerade simuleringsprogram för detta. Det är korrekt att man omger det klyvbara materialet med en s.k. "tamper". Detta är ett lager av ett tungt ämne som "håller ihop" det klyvbara materialet och reflekterar in neutroner. För ökad effekt använder man ofta utarmat uran (238U) som tamper eftersom det är klyvbart med snabba neutroner.

Ett kärnvapen i rymden har ganska begränsad verkan (se fråga 13679 ), utom för närområdet och, om explosionen sker nära jorden, kan det producera en EMP, se fråga 13095

Se vidare Neutron_reflector#Nuclear_weapons .
/Peter E

Nyckelord: kärnvapen [15];

*

Materiens innersta-Atomer-Kärnor [19142]

Fråga:
Hur kan man utnyttja radioaktivitet i olika sammanhang?
/Elliot A, Mälarhöjdens skola, Hägersten

Svar:
Elliot! Det finns massor av tillämpningar av radioaktivitet/kärnfysik. Här är några:

Medicinska tillämpningar (diagnos och terapi t.ex. PET , strålbehandling), Brandvarnare , nivåmätare, kärnenergi , kärnvapen , radioaktiv datering , radioaktiva spårämnen, elementanalys.
/Peter E

1 http://answers.yahoo.com/question/index?qid=20071107062557AAq6ouw

*

Materiens innersta-Atomer-Kärnor [19672]

Fråga:
Hur fungerar ett kärnvapen och en kärnreaktor?
/Johan T, Romedalsskolan

Svar:
Den enda likheten är att båda bygger på klyvning av tunga kärnor, se fråga 14847 . Kärnvapen (se fråga 13679 ) är förfärliga vapen och kärnreaktorer (se fråga 13180 ) är en koldioxidfri energikälla.
/Peter E

*

Materiens innersta-Atomer-Kärnor [20579]

Fråga:
Atomvapen och kärnkraftverk har likheter men också skillnader, redogör för dessa likheter och skillnaderna.
/mats n, nackaskolan, Stockholm

Svar:
Det ser ut som ämnet för ett projektarbete. Tanken är, tror jag, att du själv skall fundera och skriva. Använd gärna befintliga frågor som utgångspunkt: kärnvapen och kärnenergi
/Peter E

*

Materiens innersta-Atomer-Kärnor [20696]

Fråga:
I slutet av 1930-talet gjorde två fysiker en intressant upptäckt. De besköt urankärnor med neutroner. Resultatet blev den första kärnklyvningen. Ge exempel, både positiva och negativa, på hur upptäckten har förändrat levnadsvillkoren för oss människor
/Nael N

Svar:
Det låter som ett ämne för litteraturstudier. Jag tror du lär dig mest om du själv gör arbetet . Här är lite tips för att komma igång:

Vad fission är och upptäckten beskrivs mycket väl med många referenser i Wikipedia, Nuclear_fission . Där finns även länkar till information om de viktigaste tillämpningarna: kärnvapen och kärnreaktioner.

Se även Fission , Kärnenergi och Kärnvapen .
/Peter E

*

Materiens innersta-Atomer-Kärnor [20813]

Fråga:
Jag har ärvt en liten burk som jag tror kommer från Hiroshima. Tydligen plockade min morfar upp den när, som sjöman i det Brittiska kungliga flottan, hans skepp stannade i Hiroshima snart efter staden blev bombad under andra världskriget.

Jag har ingen aning om burken är radioaktiv och i så fall om den är farlig men vill gärna ta reda eventuella risker som kan finnas.

Vet inte om detta är någonting du kan råda om eller om du känner någon som kan hjälpa mig. Jag vet inte exakt vart jag ska vända mig till för hjälp bara och all hjälp du bistå med uppskattas högst.
/Benjamin D

Svar:
Benjamin! Nej, innehållet i din burk är inte farligt av flera skäl. Du kan utan fara ställa burken i bokhyllan. Om du ändå är orolig kan du alltid gräva ner innehållet i trädgården, s.k. slutförvaring.

I dag finns i Hiroshima inga restriktioner på grund av strålningsrisker. I fråga 13679 diskuteras skillnaden mellan radioaktivitet från kärnvapen och från kärnkraftverk.

Strålningsfaran i Hiroshima sammanfattas bra i länk 1 och 2. Mot slutet i länk 1 finns även historien om den stackars mannen som på några dagar utsattes för två kärnvapenattacker.
/Peter E

Nyckelord: kärnvapen [15]; Hiroshima/Nagasaki [4];

1 https://zidbits.com/2013/11/is-nagasaki-and-hiroshima-still-radioactive/
2 https://www.quora.com/Why-were-Nagasaki-and-Hiroshima-habitable-after-1945-and-Chernobyl-not-after-their-meltdowns-Whats-the-difference

*

Sök efter    

Skriv de ord du vill söka på i sökfältet ovan och klicka på sökknappen. Uteslut ord genom att sätta - (minus) före ordet. Ordgrupper definieras med hjälp av "...". Sökningar är oberoende av stora och små bokstäver.

Exempel:

helium "kalle anka"
Sök på 'helium' och ordgruppen 'kalle anka'
orgelpipa
Sök på 'orgelpipa'
orgel -gitarr
Sök på 'orgel' men inte 'gitarr'

 


sök | söktips | Veckans fråga | alla 'Veckans fråga' | ämnen | dokumentation | ställ en fråga
till diskussionsfora

 

Creative Commons License

Denna sida från NRCF är licensierad under Creative Commons:
Erkännande-Ickekommersiell-Inga bearbetningar
.